ID: 1122480235

View in Genome Browser
Species Human (GRCh38)
Location 14:102042489-102042511
Sequence CATGGAGATCAACCCCAAGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 145}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122480228_1122480235 6 Left 1122480228 14:102042460-102042482 CCGCATGCCTGCTTCCGACTCTT 0: 1
1: 0
2: 1
3: 16
4: 172
Right 1122480235 14:102042489-102042511 CATGGAGATCAACCCCAAGGTGG 0: 1
1: 0
2: 0
3: 6
4: 145
1122480227_1122480235 13 Left 1122480227 14:102042453-102042475 CCTGCAGCCGCATGCCTGCTTCC 0: 1
1: 0
2: 1
3: 32
4: 286
Right 1122480235 14:102042489-102042511 CATGGAGATCAACCCCAAGGTGG 0: 1
1: 0
2: 0
3: 6
4: 145
1122480229_1122480235 -1 Left 1122480229 14:102042467-102042489 CCTGCTTCCGACTCTTCCTCACC 0: 1
1: 0
2: 1
3: 24
4: 334
Right 1122480235 14:102042489-102042511 CATGGAGATCAACCCCAAGGTGG 0: 1
1: 0
2: 0
3: 6
4: 145
1122480226_1122480235 14 Left 1122480226 14:102042452-102042474 CCCTGCAGCCGCATGCCTGCTTC 0: 1
1: 0
2: 1
3: 16
4: 175
Right 1122480235 14:102042489-102042511 CATGGAGATCAACCCCAAGGTGG 0: 1
1: 0
2: 0
3: 6
4: 145
1122480231_1122480235 -8 Left 1122480231 14:102042474-102042496 CCGACTCTTCCTCACCATGGAGA 0: 1
1: 0
2: 4
3: 23
4: 286
Right 1122480235 14:102042489-102042511 CATGGAGATCAACCCCAAGGTGG 0: 1
1: 0
2: 0
3: 6
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122480235 Original CRISPR CATGGAGATCAACCCCAAGG TGG Exonic