ID: 1122480242

View in Genome Browser
Species Human (GRCh38)
Location 14:102042505-102042527
Sequence AAGGTGGGTGGTTGAAGGAG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 584
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 544}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122480228_1122480242 22 Left 1122480228 14:102042460-102042482 CCGCATGCCTGCTTCCGACTCTT 0: 1
1: 0
2: 1
3: 16
4: 172
Right 1122480242 14:102042505-102042527 AAGGTGGGTGGTTGAAGGAGTGG 0: 1
1: 0
2: 3
3: 36
4: 544
1122480232_1122480242 -1 Left 1122480232 14:102042483-102042505 CCTCACCATGGAGATCAACCCCA 0: 1
1: 0
2: 0
3: 16
4: 129
Right 1122480242 14:102042505-102042527 AAGGTGGGTGGTTGAAGGAGTGG 0: 1
1: 0
2: 3
3: 36
4: 544
1122480229_1122480242 15 Left 1122480229 14:102042467-102042489 CCTGCTTCCGACTCTTCCTCACC 0: 1
1: 0
2: 1
3: 24
4: 334
Right 1122480242 14:102042505-102042527 AAGGTGGGTGGTTGAAGGAGTGG 0: 1
1: 0
2: 3
3: 36
4: 544
1122480231_1122480242 8 Left 1122480231 14:102042474-102042496 CCGACTCTTCCTCACCATGGAGA 0: 1
1: 0
2: 4
3: 23
4: 286
Right 1122480242 14:102042505-102042527 AAGGTGGGTGGTTGAAGGAGTGG 0: 1
1: 0
2: 3
3: 36
4: 544
1122480226_1122480242 30 Left 1122480226 14:102042452-102042474 CCCTGCAGCCGCATGCCTGCTTC 0: 1
1: 0
2: 1
3: 16
4: 175
Right 1122480242 14:102042505-102042527 AAGGTGGGTGGTTGAAGGAGTGG 0: 1
1: 0
2: 3
3: 36
4: 544
1122480234_1122480242 -6 Left 1122480234 14:102042488-102042510 CCATGGAGATCAACCCCAAGGTG 0: 1
1: 0
2: 1
3: 12
4: 135
Right 1122480242 14:102042505-102042527 AAGGTGGGTGGTTGAAGGAGTGG 0: 1
1: 0
2: 3
3: 36
4: 544
1122480227_1122480242 29 Left 1122480227 14:102042453-102042475 CCTGCAGCCGCATGCCTGCTTCC 0: 1
1: 0
2: 1
3: 32
4: 286
Right 1122480242 14:102042505-102042527 AAGGTGGGTGGTTGAAGGAGTGG 0: 1
1: 0
2: 3
3: 36
4: 544

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122480242 Original CRISPR AAGGTGGGTGGTTGAAGGAG TGG Exonic