ID: 1122480598

View in Genome Browser
Species Human (GRCh38)
Location 14:102044739-102044761
Sequence GAGGGTCCCCTCACGCGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 70}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122480591_1122480598 -2 Left 1122480591 14:102044718-102044740 CCCACACGCAGGGTGGGTGGCGA 0: 1
1: 0
2: 1
3: 2
4: 65
Right 1122480598 14:102044739-102044761 GAGGGTCCCCTCACGCGGGGTGG 0: 1
1: 0
2: 0
3: 3
4: 70
1122480592_1122480598 -3 Left 1122480592 14:102044719-102044741 CCACACGCAGGGTGGGTGGCGAG 0: 1
1: 1
2: 1
3: 8
4: 123
Right 1122480598 14:102044739-102044761 GAGGGTCCCCTCACGCGGGGTGG 0: 1
1: 0
2: 0
3: 3
4: 70
1122480583_1122480598 26 Left 1122480583 14:102044690-102044712 CCACACAGGGTAGGCAACAAGGA 0: 1
1: 0
2: 1
3: 21
4: 144
Right 1122480598 14:102044739-102044761 GAGGGTCCCCTCACGCGGGGTGG 0: 1
1: 0
2: 0
3: 3
4: 70
1122480590_1122480598 -1 Left 1122480590 14:102044717-102044739 CCCCACACGCAGGGTGGGTGGCG 0: 1
1: 0
2: 1
3: 9
4: 119
Right 1122480598 14:102044739-102044761 GAGGGTCCCCTCACGCGGGGTGG 0: 1
1: 0
2: 0
3: 3
4: 70
1122480588_1122480598 2 Left 1122480588 14:102044714-102044736 CCTCCCCACACGCAGGGTGGGTG 0: 1
1: 1
2: 1
3: 15
4: 212
Right 1122480598 14:102044739-102044761 GAGGGTCCCCTCACGCGGGGTGG 0: 1
1: 0
2: 0
3: 3
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122480598 Original CRISPR GAGGGTCCCCTCACGCGGGG TGG Intronic
901440028 1:9272224-9272246 GAGGGTCCCCAAACGGGGGCTGG - Intergenic
903227897 1:21904195-21904217 GAGGGTCCCCTCACTTAGGGAGG + Intronic
903388385 1:22945110-22945132 AAGGGTCCCCTGAGCCGGGGAGG - Intergenic
904432012 1:30470357-30470379 GACGGGCCCCTCAGGCAGGGAGG + Intergenic
907970580 1:59377119-59377141 GAGGGTCCTCTCAGTTGGGGTGG + Intronic
1077302970 11:1855617-1855639 GAAGGTCCCCTGACCCTGGGCGG + Intronic
1077401097 11:2357859-2357881 GAGAGGCCCCTCAGGTGGGGCGG - Intergenic
1077544987 11:3165308-3165330 GATGGTCCCCCCGCGCGAGGCGG + Exonic
1089556764 11:119319462-119319484 GAGGGTCCCCTCATGTGTGAGGG - Intronic
1089603847 11:119630366-119630388 GAGGGCTCCCGCACGCCGGGAGG + Intronic
1091595884 12:1878881-1878903 GAGGCTCCCATCACGGGGGAGGG + Intronic
1092538462 12:9405950-9405972 TTAGGTCCCCTAACGCGGGGGGG + Intergenic
1096466060 12:51848329-51848351 GAGGGTCACTTCTCGGGGGGAGG - Intergenic
1102177766 12:110888383-110888405 GAGGGTCCCCTTATGAGGAGTGG - Intronic
1104800786 12:131554166-131554188 GAGGGTCTGGTCACGAGGGGAGG - Intergenic
1109645152 13:65244539-65244561 GAGGGTCGCCTGACTCTGGGAGG - Intergenic
1118328072 14:64794962-64794984 GAGGTTGCCCTCATGCTGGGAGG + Intronic
1118849428 14:69572891-69572913 GAGGGCGCCCTCACGCCGGCGGG + Exonic
1121127659 14:91418105-91418127 CTGGGGCCCCACACGCGGGGAGG - Intergenic
1122480598 14:102044739-102044761 GAGGGTCCCCTCACGCGGGGTGG + Intronic
1125560686 15:40630708-40630730 GAGGGTCCCATCTCGGGGTGGGG - Intronic
1132632659 16:927354-927376 GAGGGTTCCCTCAAACCGGGAGG - Intronic
1132646695 16:1002503-1002525 GTGGGTTCCTTCACCCGGGGAGG - Intergenic
1133151010 16:3830306-3830328 GAGGATCACCTCACCCGGGGTGG + Intronic
1143163556 17:4886402-4886424 GAGGGTCCCCTCAGAAGGGATGG - Intronic
1147588617 17:41667026-41667048 GAGGGTCCCCTCTCTAGGGCTGG - Intergenic
1151719594 17:75847659-75847681 GAGGCCCCCCTCACCCGGGAGGG - Intronic
1152114649 17:78378222-78378244 GAGGATCCCCTGAGGCCGGGAGG + Intergenic
1156144555 18:34159614-34159636 GAGGGACCCCTCCGGCGAGGCGG - Intronic
1160613835 18:80109339-80109361 GGGGGTCCCGCCGCGCGGGGCGG + Exonic
1160679530 19:406464-406486 GAGGGTGCCCTGACGAGGGTGGG - Exonic
1161026166 19:2038414-2038436 GAACGTCCCCACCCGCGGGGAGG + Exonic
1161189532 19:2945321-2945343 GAGCGGCCCCTCGTGCGGGGAGG + Intergenic
1161868022 19:6848881-6848903 GAGGGTCCCCTGAATCTGGGAGG - Intronic
1162406759 19:10479492-10479514 CAGGGTCCCCTCAAGAAGGGCGG - Intergenic
1162960074 19:14120423-14120445 GAGTGTCCCAGCACGCCGGGAGG - Exonic
1163220463 19:15914699-15914721 GAGGGGTCCCTCAGGCAGGGGGG - Intronic
928186661 2:29116009-29116031 GAGAGTCCCCGCACGCGCAGTGG + Intronic
929157981 2:38804851-38804873 GAGGGGCCCTGCACGTGGGGTGG - Intronic
932776187 2:74529722-74529744 TCGGGTCCCCTCACCCCGGGCGG - Exonic
936288689 2:111201078-111201100 GAGGGGCCACTCACGCTAGGGGG - Intergenic
1173337337 20:42123513-42123535 GAGGGTCCCCTCAGAGGAGGTGG + Intronic
1173901854 20:46596126-46596148 GAGAGTCCCCACCGGCGGGGAGG - Intronic
1175895684 20:62334661-62334683 GAGGGGCCCCTGAGGCTGGGTGG - Intronic
1175976241 20:62711731-62711753 GAGAGCCCACGCACGCGGGGAGG - Intronic
1179543949 21:42101870-42101892 GAGGGTCCTTTCCCGTGGGGTGG - Intronic
1180748974 22:18111335-18111357 CACGGTCCCCCCACGCGTGGAGG + Intronic
1181934371 22:26428633-26428655 GAGGGTCCCCTCCCGCTAGACGG + Intergenic
1182618325 22:31603688-31603710 GAGGGTGCCCTCACTGGGTGGGG + Intronic
1184246452 22:43238103-43238125 GAGGGTCCCCTCAACCCAGGAGG + Intronic
1185408447 22:50670956-50670978 GAGGGTCCTCTCCCGAGGTGTGG + Intergenic
956793716 3:72700063-72700085 GCGGGTCCCCTCCCGTTGGGAGG - Intergenic
966712183 3:182981344-182981366 GAGGGTCTAGTCACGCAGGGCGG + Intronic
985538824 5:478525-478547 GGGGGTCCCCACACCTGGGGTGG - Intronic
985638586 5:1052599-1052621 GAGAGACCCCCCAGGCGGGGAGG + Intronic
996871437 5:128197706-128197728 GAGGGTCCCCTCTCTGGAGGTGG - Intergenic
1014754691 6:125289844-125289866 GAGGCTCCCCTCACGCCTTGGGG + Intronic
1015329356 6:131959214-131959236 GTGGGTCCCCCCTCTCGGGGAGG - Intergenic
1016746981 6:147591417-147591439 GAGGGTCACCGCACTCGGGAGGG + Intronic
1019483183 7:1275490-1275512 GAGGGTCCCCGCAGCCGGGCGGG - Intergenic
1026886114 7:73947440-73947462 GAGGATCCCTTCAGGCCGGGAGG - Intergenic
1029591082 7:101507509-101507531 GAGGATCACCTGAGGCGGGGAGG - Intronic
1034801576 7:154059034-154059056 GAGGGACCCCCCACGAGGCGGGG + Intronic
1035695397 8:1591899-1591921 GAGGTTCCTCCCACCCGGGGCGG + Intronic
1036402204 8:8418860-8418882 GAGGGTGCGCTCACCCTGGGTGG + Intergenic
1036621564 8:10427581-10427603 GAGTGTCCCCTCACTCGCTGTGG - Intronic
1049577823 8:143397811-143397833 GAGGGGCCCCTCACCCAGGAAGG + Intergenic
1057221402 9:93259642-93259664 GAGGGTCCCCAGACGCTGGGAGG - Intronic
1057758371 9:97854125-97854147 GAGCGCCGCCTCACGCTGGGCGG + Exonic
1059378825 9:113907652-113907674 CAGGGGCCTCTCATGCGGGGGGG - Intronic
1062339853 9:136089199-136089221 GAGGGTCCCCTGGCAGGGGGAGG - Intronic
1062579261 9:137222295-137222317 GCGGGTCCCCAGACGGGGGGTGG - Intergenic
1192016789 X:67339850-67339872 GAGAGTCCCCTCATGCTGTGTGG + Intergenic
1192225745 X:69226761-69226783 AAGGGCCCCCACACCCGGGGGGG - Intergenic