ID: 1122484661

View in Genome Browser
Species Human (GRCh38)
Location 14:102070719-102070741
Sequence CAAAATAAGCAGGGGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122484651_1122484661 18 Left 1122484651 14:102070678-102070700 CCTGGGCAACATAATGAGGCCCT 0: 15
1: 412
2: 5470
3: 24239
4: 68784
Right 1122484661 14:102070719-102070741 CAAAATAAGCAGGGGGTGGAGGG No data
1122484649_1122484661 22 Left 1122484649 14:102070674-102070696 CCAGCCTGGGCAACATAATGAGG 0: 48
1: 1338
2: 15285
3: 61499
4: 147663
Right 1122484661 14:102070719-102070741 CAAAATAAGCAGGGGGTGGAGGG No data
1122484652_1122484661 -1 Left 1122484652 14:102070697-102070719 CCCTGTCTCAAAAAAAACCGCAC No data
Right 1122484661 14:102070719-102070741 CAAAATAAGCAGGGGGTGGAGGG No data
1122484653_1122484661 -2 Left 1122484653 14:102070698-102070720 CCTGTCTCAAAAAAAACCGCACA No data
Right 1122484661 14:102070719-102070741 CAAAATAAGCAGGGGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122484661 Original CRISPR CAAAATAAGCAGGGGGTGGA GGG Intergenic
No off target data available for this crispr