ID: 1122486682

View in Genome Browser
Species Human (GRCh38)
Location 14:102086852-102086874
Sequence AGCGCGGCCGCCCGGGAGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 220}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122486670_1122486682 28 Left 1122486670 14:102086801-102086823 CCTGAAGCGGGGTGCGGAAACCG 0: 1
1: 0
2: 0
3: 2
4: 35
Right 1122486682 14:102086852-102086874 AGCGCGGCCGCCCGGGAGCGCGG 0: 1
1: 0
2: 1
3: 17
4: 220
1122486678_1122486682 -9 Left 1122486678 14:102086838-102086860 CCTCCGGAATAGAAAGCGCGGCC 0: 1
1: 0
2: 0
3: 0
4: 19
Right 1122486682 14:102086852-102086874 AGCGCGGCCGCCCGGGAGCGCGG 0: 1
1: 0
2: 1
3: 17
4: 220
1122486673_1122486682 8 Left 1122486673 14:102086821-102086843 CCGCAGCGGTCCCGAGGCCTCCG 0: 1
1: 0
2: 1
3: 8
4: 156
Right 1122486682 14:102086852-102086874 AGCGCGGCCGCCCGGGAGCGCGG 0: 1
1: 0
2: 1
3: 17
4: 220
1122486675_1122486682 -2 Left 1122486675 14:102086831-102086853 CCCGAGGCCTCCGGAATAGAAAG 0: 1
1: 0
2: 0
3: 27
4: 213
Right 1122486682 14:102086852-102086874 AGCGCGGCCGCCCGGGAGCGCGG 0: 1
1: 0
2: 1
3: 17
4: 220
1122486676_1122486682 -3 Left 1122486676 14:102086832-102086854 CCGAGGCCTCCGGAATAGAAAGC 0: 1
1: 0
2: 0
3: 10
4: 107
Right 1122486682 14:102086852-102086874 AGCGCGGCCGCCCGGGAGCGCGG 0: 1
1: 0
2: 1
3: 17
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122486682 Original CRISPR AGCGCGGCCGCCCGGGAGCG CGG Intronic
900215356 1:1478767-1478789 AGGGAGGCCGCCCGGCTGCGGGG + Intronic
900222617 1:1517434-1517456 AGGGAGGCCGCCCGGCTGCGGGG + Intronic
900244272 1:1630317-1630339 GGCGCGGCGGGCCGGGGGCGGGG - Exonic
900513070 1:3069450-3069472 AGCCCGGTCGCCCCGGAGCGCGG - Intronic
900641715 1:3690794-3690816 GTCGTGGCCGCCCGGCAGCGTGG - Intronic
901086274 1:6613991-6614013 AGCGGGGCCGCCCGGGGCTGGGG - Exonic
902323577 1:15684333-15684355 AGCGCGGCCGGCGGGGAAGGAGG - Exonic
903962365 1:27064805-27064827 AGGGCGGCCGGCCGGGCGGGGGG - Intergenic
904720019 1:32500710-32500732 AGGCCGGCCGGCCGGGCGCGGGG - Intronic
905553020 1:38859332-38859354 AGCGGGGACGCCCGGGAGGGCGG - Intronic
906035999 1:42750703-42750725 AGGGCGGCCGGCCGGGCGGGGGG - Intronic
911449444 1:98045541-98045563 AGCGCGGCCGGCCGGGGGTGGGG + Intergenic
915213386 1:154325722-154325744 AGCGGGGGCGCCCGGGAGCGCGG + Intronic
916233340 1:162561646-162561668 GGCGGGGCGGGCCGGGAGCGGGG - Exonic
920367736 1:205456934-205456956 ACCGCGGCCGTCGGGGGGCGCGG - Intergenic
920394101 1:205631565-205631587 AGCCCCACCGGCCGGGAGCGGGG - Intronic
921556166 1:216601158-216601180 CGAGCGCCCGCCCGGGAGCCCGG - Intronic
921930268 1:220748813-220748835 AGCGCGGGCGCGGGGCAGCGCGG + Intronic
1066080804 10:31928844-31928866 AGCGCGCCGGCGCGGGGGCGGGG + Intronic
1067416373 10:46106309-46106331 AGCGGGGCCGCCAGGTCGCGCGG + Intergenic
1067436508 10:46282787-46282809 AGCGGGGCCGCCAGGTCGCGCGG + Intergenic
1067497826 10:46775125-46775147 AGTGCGGCTGCCAGGGAGGGCGG - Intergenic
1067694394 10:48524361-48524383 CGCGGGGCCGCCCCGGCGCGCGG - Intronic
1069709169 10:70478304-70478326 AGCGAGGCCGGCCCGGAGCCCGG + Intergenic
1075430309 10:122374825-122374847 AACGCGGCCGCGCTGGAGCAGGG + Intronic
1076721664 10:132395964-132395986 CGCGCGGCCGCCGGAGGGCGAGG + Intergenic
1077016305 11:400478-400500 AGAGCGGCGGCCCGGGGGCACGG - Intronic
1077227224 11:1443650-1443672 AGCGGGGCGGCCCCAGAGCGTGG + Intronic
1077322190 11:1947450-1947472 CGCGCGGACTCCGGGGAGCGGGG + Intronic
1077976261 11:7251854-7251876 CTCGCGGCCGCCGGGGGGCGGGG - Intronic
1081589441 11:44410941-44410963 AGCCCAGCTGCCCTGGAGCGGGG + Intergenic
1081851535 11:46278052-46278074 CGCGCCGCCGCCCTGGAGTGAGG + Exonic
1082810504 11:57476592-57476614 GGCGCGGCTGCCCGGCCGCGTGG - Exonic
1083621486 11:64051505-64051527 AGCTCTGCCGCCCAGGAGCCAGG - Intronic
1083726296 11:64630318-64630340 AGTGCGGCCGCACCGGGGCGGGG - Intronic
1084151348 11:67289301-67289323 AGCGCGGGCGGCAGGGAGGGCGG - Exonic
1085011101 11:73142232-73142254 CAGGCGGCCGACCGGGAGCGCGG - Exonic
1086361853 11:86068607-86068629 CGCGCGGGCGCCGGGGAGCGGGG + Intronic
1086590482 11:88509179-88509201 AGCGCGGCCGCGCGGGCGCCGGG + Exonic
1089694850 11:120210798-120210820 CGCGCGGCCGGGCGGGAGGGAGG + Exonic
1090636374 11:128692877-128692899 CGCGCGGCGGCCCAGGAGGGAGG + Intronic
1090977889 11:131691681-131691703 GGCGGGGCCGAGCGGGAGCGCGG - Intronic
1202805208 11_KI270721v1_random:2763-2785 CGCGCGGACTCCGGGGAGCGGGG + Intergenic
1100260662 12:92929343-92929365 CCCGCGGCCGCCGGGGGGCGGGG + Intergenic
1103954247 12:124567581-124567603 GCCGCGGCCGCCGGGGAGCGCGG - Intronic
1104049489 12:125186269-125186291 GGAGGGGCCGCCCGGGAGCCGGG - Intergenic
1106517133 13:30465296-30465318 AGCGCGGCCAGCCGGGCGGGCGG - Intronic
1107123497 13:36819727-36819749 AGCGGGGGCGCCCGGAGGCGGGG + Exonic
1113805854 13:113109771-113109793 AGCACGGCCGCCCCGGGGCGGGG + Intronic
1117978813 14:61322066-61322088 AGCGCGGCCCCCCGGGGCCGGGG + Exonic
1118725818 14:68628445-68628467 AGCAGGGCGGCCCGGGAGCTGGG - Intronic
1121127610 14:91417972-91417994 AGCCCGGGAGCCCGGGAGCCCGG + Intergenic
1122220781 14:100238391-100238413 GGAGGGGCCGGCCGGGAGCGGGG - Intronic
1122274884 14:100586405-100586427 AGAGTGGGCACCCGGGAGCGGGG - Intronic
1122486682 14:102086852-102086874 AGCGCGGCCGCCCGGGAGCGCGG + Intronic
1122649814 14:103220327-103220349 AGAGGGTCGGCCCGGGAGCGCGG - Intergenic
1122776101 14:104117599-104117621 GGGGCGGCCGACCTGGAGCGCGG - Intergenic
1122917324 14:104865190-104865212 GGCGCGGCCGGGCGGGGGCGGGG + Intergenic
1123013849 14:105364257-105364279 AGGGCTGCAGCCCGGGTGCGCGG + Intronic
1123441443 15:20294925-20294947 AGGCCGGGCGCGCGGGAGCGGGG + Intergenic
1126786200 15:52179636-52179658 CGCGCCACCGCCCGGGAGCAGGG - Intronic
1126852557 15:52805971-52805993 AGCTAGGCCACCCGGGAGCCTGG - Intergenic
1128262706 15:66243483-66243505 AGGGCGGCCAGCTGGGAGCGGGG + Intronic
1132544712 16:527890-527912 AGCGCGGCCGGCGGCGAGAGGGG + Exonic
1132789705 16:1678654-1678676 AACGCGGGCGCCCAGGCGCGAGG - Intronic
1132838092 16:1964701-1964723 AGGGCTCCCGCCCAGGAGCGCGG + Intronic
1132899250 16:2244375-2244397 AGCGAGGCCACCTGGGAGTGGGG + Intronic
1134290781 16:12901801-12901823 AGCGCGCCCGGCCGGGCGGGGGG - Exonic
1135135827 16:19884927-19884949 GGCGGGGCCGGCCGGGGGCGGGG - Intronic
1135976148 16:27109950-27109972 GGCGCGGCGGGGCGGGAGCGGGG - Intergenic
1136245799 16:28975133-28975155 GGCGCGGCCCCCCGGGACCATGG + Exonic
1136390615 16:29962067-29962089 AGCGGGGCCGCGAGGGGGCGGGG - Intronic
1136627801 16:31472458-31472480 CCCGCGGGCGCCCGGGCGCGGGG + Intronic
1138193200 16:55033467-55033489 AGCGCTCCCGCCCTGGAACGTGG + Intergenic
1138595125 16:58025730-58025752 AGCGCGGCGGCCGCGGCGCGCGG + Exonic
1139761540 16:69187750-69187772 AGCGGGGCCGGGCGGGAGGGTGG + Intronic
1141624615 16:85254682-85254704 AGTGCTGCCGCCCAGGAGCACGG - Intergenic
1142130898 16:88431011-88431033 GGAGCGGCCGCCAGGGAGGGAGG + Exonic
1142376438 16:89709274-89709296 TGCGCGGCGGCCCAGGAGCTCGG - Exonic
1142670586 17:1485858-1485880 AGCCCGGCCGCGCGGGAGGCGGG - Intronic
1145970179 17:28951546-28951568 ACCGCGGCTGCGCGGGAGCCAGG - Exonic
1146403703 17:32519608-32519630 AGCGCGGCCGGCCGGGGCTGCGG - Intronic
1147121020 17:38335131-38335153 ACCGTGGGCGCCCTGGAGCGAGG - Exonic
1147440333 17:40443664-40443686 AGCGCGGGCGCGCGGGCGAGCGG - Exonic
1148060131 17:44830325-44830347 CCCGCCGCGGCCCGGGAGCGGGG + Intronic
1148489183 17:48012366-48012388 ACCGCGGCCTCCGGGGCGCGCGG - Intergenic
1148899600 17:50866108-50866130 AGCGCGGCAGGGCGGGGGCGCGG + Exonic
1149545924 17:57504022-57504044 ACCGCGCCCGGCCGGGAGAGAGG + Intronic
1150217119 17:63476996-63477018 AGCGCGGCGGGGCGGGGGCGGGG + Intergenic
1150643746 17:66965629-66965651 GGCGGGGCCGGCCGGGGGCGGGG + Intronic
1150683940 17:67305188-67305210 ACCGCGCCCGGCCGGGAGCTCGG - Intergenic
1151987789 17:77555353-77555375 AGCGAGCACGCCCGGGAGCTGGG + Intergenic
1152227286 17:79098302-79098324 AGAGCGGCTGTCCGGGAGGGTGG + Intronic
1152552215 17:81035445-81035467 GGCGCGGCCACCCGGGACCCGGG + Intronic
1152648580 17:81481655-81481677 AGCGCCCCCGCCCCGGAGCAGGG + Intergenic
1152744186 17:82031596-82031618 AGCGCGGCCGGCGGGGGGCGGGG - Intergenic
1153814910 18:8783710-8783732 AGCTCGGCCTCCCGGGTGCTGGG - Exonic
1156294273 18:35775478-35775500 AGCGTGGCCGCCAGGGAGCTAGG - Intergenic
1157614002 18:48976163-48976185 AGGGCGGGCCCGCGGGAGCGGGG + Intergenic
1160164298 18:76496151-76496173 AGGGCGGGCGCGCGGGGGCGGGG + Intronic
1160668524 19:344723-344745 GGCGCGGACGCGCGGGGGCGGGG + Intronic
1160893987 19:1394426-1394448 AGCGCGGTCCCCAGGGAGGGAGG - Intronic
1160894024 19:1394542-1394564 AGCGCGGTCCCCAGGGAGGGAGG - Intronic
1161029446 19:2050986-2051008 AGCCCGGCCTGCCAGGAGCGCGG + Intronic
1161176049 19:2842417-2842439 AGCGGGGACGCCCGGGAGGCTGG + Intronic
1161203591 19:3029070-3029092 AGCGCGCGCGCCCGGGGTCGTGG + Exonic
1161215650 19:3094135-3094157 GGCGGGGCCGCCCGGGATTGTGG - Intergenic
1161241142 19:3224637-3224659 GGCGCGGGGGCCCGGGAGGGAGG + Intergenic
1162128236 19:8510866-8510888 GGCGCGGCGGCCCGGCCGCGGGG + Exonic
1162911004 19:13847719-13847741 CTGGCGGCCGGCCGGGAGCGGGG - Intergenic
1162921552 19:13906237-13906259 GGCGCCGCCGCACCGGAGCGCGG - Exonic
1162954670 19:14091232-14091254 AGCGCGGCAGCCCCGGCCCGCGG - Intergenic
1162975894 19:14206825-14206847 AGCGGGTGCGCCGGGGAGCGGGG - Intergenic
1164658562 19:29942415-29942437 GGCGCGGCCTCCTGGGCGCGGGG + Exonic
1165746014 19:38229725-38229747 AGCGGGGCGGGCCGGGGGCGGGG + Intergenic
1167258033 19:48442770-48442792 CGCGGGGCCGCCGGGGGGCGCGG + Exonic
1167337378 19:48895376-48895398 AGCGCGGCCTCCCGACACCGCGG - Exonic
1167411584 19:49347291-49347313 AGCGCCGCCGCTCGAGAGTGTGG - Exonic
1167428423 19:49441435-49441457 GACGCGGCCGCCCGGGCCCGCGG - Exonic
924985169 2:264147-264169 AGCGCGGCCCGGCGGGCGCGTGG - Intronic
925068888 2:950954-950976 AGCTCGGCCGGCCCGGAGCGCGG + Exonic
925128017 2:1475738-1475760 AGCGCTTCCGGCCGGGCGCGGGG - Intronic
925922104 2:8645095-8645117 GACGCGGCCACCAGGGAGCGTGG - Intergenic
927698241 2:25251918-25251940 AGAGCAGCCGGCCGGGAGCCCGG - Intronic
927964786 2:27262271-27262293 CGGGCGGCCGCCGGGAAGCGAGG - Intronic
928606188 2:32947076-32947098 AGCGCGGAGCCCGGGGAGCGGGG - Exonic
932399007 2:71466738-71466760 GGCGCGGCTGCCTGGGAGCCGGG + Exonic
936433290 2:112482313-112482335 TGCCCGGCGGCCCGGGCGCGCGG + Exonic
938005909 2:127788273-127788295 AGGGCGGCCGGCCGGGCGGGGGG + Intronic
940962237 2:159798244-159798266 AGCGGGGCGGGGCGGGAGCGGGG + Intronic
941112141 2:161427251-161427273 AGCGCGGGAGCCCTGGAGCCCGG + Intronic
1170150492 20:13221676-13221698 AGCCCGGGAGCCCGGCAGCGCGG - Intergenic
1171010331 20:21505974-21505996 GGGGAGGCGGCCCGGGAGCGCGG - Intergenic
1172245657 20:33443629-33443651 AGCGCGGCGGCCCGGGGGCTCGG - Exonic
1172618748 20:36306547-36306569 AGCGCGCCGGCCCGGGAAGGGGG - Intronic
1175847409 20:62065911-62065933 CGCGCGGCCGGCGGGGGGCGGGG + Intergenic
1177431681 21:20998224-20998246 AGAGCGGCCGCCGTGCAGCGCGG + Intergenic
1177792494 21:25735582-25735604 AGTGCGGCCGCCGGGGAGGAGGG + Intronic
1178953978 21:37006887-37006909 AGCGCGTCCACCGGGGCGCGGGG - Intronic
1178962030 21:37073768-37073790 CACGCAGCCGCCAGGGAGCGCGG - Intronic
1178992691 21:37367855-37367877 GCCGCGGCCTCCCGGGAGCCGGG + Intronic
1180014569 21:45074082-45074104 AGCGCGGGGGCCCGGGAGCCTGG + Intronic
1181934649 22:26429694-26429716 AGCGCCGCCGCCTCGGAGCCGGG + Intronic
1182331412 22:29553764-29553786 GGGGCGGCCGACCGGAAGCGAGG + Exonic
1184127941 22:42500874-42500896 AGCGCGACCGGCCGGGAGTTGGG + Intergenic
1184662613 22:45972322-45972344 AGCGCCGCCGCCCTGCATCGGGG - Intronic
950829244 3:15859017-15859039 ACCGCTCCCGCCCGGCAGCGGGG + Intronic
950940413 3:16885162-16885184 AGCGCGCCCGCCCGTGGCCGAGG - Intronic
951485208 3:23202976-23202998 CGCGCGGCCGCGAGGGGGCGGGG - Intergenic
953959541 3:47256530-47256552 AGGGCGGCCGGCCGGGCGGGGGG - Intronic
954615578 3:51967466-51967488 AGCCCGGCCGGCCCGGAGCCCGG + Intronic
961348251 3:126278755-126278777 AGCGCAGCTGCCAGGGAGCGGGG - Intergenic
961664353 3:128486824-128486846 CGCGCGCCCGCGCGTGAGCGGGG + Exonic
962095109 3:132285212-132285234 AGCCAGGCCGCCCAGCAGCGGGG + Intronic
962112825 3:132470868-132470890 AGGGCGGCCGGCCGGGCGGGGGG + Intronic
963904613 3:150763205-150763227 TGTGCGGCCGCCCAGGCGCGCGG + Exonic
964452595 3:156826318-156826340 GGCGCGGTCGCCCGGGAGACCGG + Intronic
965390398 3:168096109-168096131 AGCGCGGCCGCCTGGCGCCGGGG + Intergenic
966684834 3:182682737-182682759 CGCGCGCCGGCCCGGGAGCCCGG + Intergenic
966808738 3:183825568-183825590 AGCGCCGCGCGCCGGGAGCGGGG - Exonic
967176251 3:186864714-186864736 AGGGCGGCCGGCCGGAAGGGGGG - Intergenic
967858301 3:194134408-194134430 GGCCCGGCCGCCCGGGACCCGGG + Intergenic
968541650 4:1171235-1171257 CGCGGGGCCGGCCGGGGGCGGGG - Intronic
968674956 4:1872001-1872023 ACCGCGGCCGCCCCGGACCGGGG - Intronic
968965320 4:3766479-3766501 GGCGCGCCCGCCGGGGACCGCGG - Exonic
969115014 4:4865975-4865997 TGCGCCGCAGCCCGGGTGCGAGG + Intergenic
969268887 4:6085446-6085468 AGAGCTCCCGCCCGGGATCGGGG - Exonic
969583182 4:8077247-8077269 AGCGGGGTCGCCCGGGAGGCAGG - Intronic
978123649 4:105110500-105110522 AGGGCGGCCGGCCGGGCGGGGGG - Intergenic
985630111 5:1009592-1009614 TGCGCACCCGCCCGGGGGCGGGG + Intronic
990545192 5:56815439-56815461 AGCGCGGCCCGCCGGGCGCCTGG - Intergenic
992813085 5:80408424-80408446 ACTCCGGCGGCCCGGGAGCGGGG - Intronic
994094311 5:95835107-95835129 AGCGCGGCGGCCCAGGACCCCGG + Intergenic
994353073 5:98769041-98769063 AGCGCCGCCGGCCCGGAGGGCGG + Intronic
996533883 5:124555867-124555889 ACCGCGCCCGGCCGGGAGTGGGG - Intergenic
997265122 5:132490836-132490858 CGCGCGGCTGTCCGGGGGCGGGG - Intergenic
1001393989 5:171403713-171403735 AGGGCGGCCGGCCGGGCGGGGGG + Intronic
1002691540 5:181053609-181053631 AGGGCGGCCACCGGGGAACGGGG + Intronic
1004044597 6:12012148-12012170 ATCGCGGCCGCCAGGGAGCCGGG - Intronic
1004627922 6:17393927-17393949 GGCGCGGCGACCCGGGCGCGGGG + Intronic
1006110211 6:31739981-31740003 AGCGCGCCGGCGCGTGAGCGAGG - Intronic
1011517138 6:88166604-88166626 AGCGGGGGCCTCCGGGAGCGCGG - Intergenic
1014001557 6:116371031-116371053 AGCCCGGGCGCCCTGGAGTGAGG + Exonic
1014556794 6:122848700-122848722 AGGGCGGCCGGCCGGGCGGGGGG + Intergenic
1014556897 6:122848929-122848951 AGGGCGGCCGGCCGGGCGGGGGG + Intergenic
1015149092 6:130019282-130019304 AGCGCGGCCGCCGAGGCGGGGGG + Intronic
1017719634 6:157235809-157235831 ACTGCGGCCGCAAGGGAGCGGGG - Intergenic
1017759797 6:157559335-157559357 AGCGCGTCAGCCAGGAAGCGGGG - Intronic
1018769020 6:166956277-166956299 AGCGCGGCGGCGCGGGGGCTCGG - Exonic
1018876488 6:167826756-167826778 GCCGCGGCCGCCAGGGAGGGAGG - Intergenic
1018959983 6:168441271-168441293 AGCGCGGCTGGGCGGGCGCGTGG - Exonic
1019112256 6:169725013-169725035 AACGCGGTCGGCCGGGAGCCGGG + Intronic
1020009307 7:4799710-4799732 TGCGGGGCTGCCCGGGAGCAGGG + Exonic
1020181327 7:5924725-5924747 AGCTCGGCTGCCCTGGAGAGAGG + Intronic
1020252977 7:6484085-6484107 AGCGCGGCGGCCCCGGGGCTGGG + Exonic
1020270293 7:6590584-6590606 AGCGAGGCCGAGCGCGAGCGCGG - Intronic
1020301606 7:6800165-6800187 AGCTCGGCTGCCCTGGAGAGAGG - Intronic
1024965481 7:55019502-55019524 TGCGCCGCCGACCGGGACCGCGG + Intronic
1025853365 7:65259374-65259396 AGGGCGGCCGGCCGGAAGGGGGG - Intergenic
1026840570 7:73668186-73668208 CGCGGGGCCGCCCGTGGGCGCGG + Intronic
1028417559 7:90596288-90596310 AGCGCGGCCGGCAGGGGGAGTGG - Intronic
1028985611 7:97006380-97006402 AGCGCAGCCGCCCAGACGCGAGG + Exonic
1029298322 7:99558904-99558926 TGCGCGGAGGCCCGGGTGCGAGG + Exonic
1029460929 7:100693755-100693777 AGCGCGCCGGCCCGGGAGGACGG + Intergenic
1029496349 7:100897100-100897122 GGCGCCGCCGCCAGGGACCGCGG + Intergenic
1029525781 7:101092694-101092716 AGCCGCCCCGCCCGGGAGCGAGG + Intergenic
1030059938 7:105614153-105614175 CGCGGGGCCGCCGGGCAGCGAGG + Exonic
1034659901 7:152759949-152759971 AGCGGGGCCGCGGAGGAGCGGGG - Intronic
1034678409 7:152909525-152909547 ATCGCAGCCGCCCTGGAGTGAGG + Intergenic
1035169857 7:157011114-157011136 AGCGTGGGCGCTCAGGAGCGTGG - Intergenic
1035404285 7:158587895-158587917 AGCGGGGCTGGCCGGGGGCGTGG - Intergenic
1035435553 7:158856707-158856729 ACCGCGGCCGCCCGGGCCTGCGG + Exonic
1035581225 8:739952-739974 ACCGCGGCAGCTCGGGCGCGTGG + Intergenic
1036788699 8:11703986-11704008 AGTGCTACCGCCAGGGAGCGGGG - Intronic
1038147928 8:24914962-24914984 CGAGCGGCCACCAGGGAGCGCGG - Intronic
1041281141 8:56211714-56211736 CGGGCTGCCGCCGGGGAGCGGGG + Intronic
1042695197 8:71547770-71547792 AGCGGGGCGGGGCGGGAGCGCGG + Intronic
1045547421 8:103141009-103141031 AGCGCCGCCGCCCCGGACAGCGG + Exonic
1047615395 8:126558431-126558453 TGCGCTCCCGCCCGGGAGCCCGG - Intergenic
1049389717 8:142361462-142361484 GGCGCTGCCTCCCAGGAGCGAGG + Intronic
1049552721 8:143267841-143267863 AGCGCGTCCGCCCGGCGGTGCGG - Intronic
1049658960 8:143811255-143811277 GGCGCTGCCGCCCGAGATCGGGG - Exonic
1049801101 8:144517872-144517894 TGCGCGGCGGGCCGGGGGCGGGG + Intergenic
1049845603 8:144799301-144799323 ACGGCGTCCGCCGGGGAGCGAGG - Intronic
1053114741 9:35490574-35490596 AGCGTGGCCGCCCGGCACCCAGG + Intronic
1054721519 9:68608981-68609003 AGCCCGGGCGCCCTGGAGTGAGG + Intergenic
1055611608 9:78030995-78031017 ACCGCGGGCGCCGGGGGGCGGGG + Intronic
1055612008 9:78032367-78032389 AGCCCACCGGCCCGGGAGCGCGG + Intergenic
1059483670 9:114611396-114611418 AGCGGGGCCGGCCGGGCGGGGGG + Exonic
1060811513 9:126613514-126613536 TGCGCGGACGGCAGGGAGCGCGG - Intergenic
1061132317 9:128714946-128714968 AGCGCACCCGCCAGGGAGCCAGG - Intronic
1061183081 9:129036603-129036625 AAACCGGCCGCCCGGGGGCGTGG - Intronic
1061455195 9:130692490-130692512 AGCCCGGCAGCCGGGGAGCCAGG - Intergenic
1062631239 9:137464084-137464106 AGGGCGGCCGCTTGGGTGCGAGG - Intronic
1062677759 9:137757828-137757850 GGTGCGGCCGCCTGGGTGCGTGG + Intronic
1062718675 9:138023616-138023638 ACCGCGGCGGCCCCCGAGCGGGG + Exonic
1190385290 X:49878668-49878690 AGCCCGGCCCCCCCGGAGCTGGG + Intergenic
1196842541 X:119871809-119871831 CCCGCGGCCGCCCGCGAGCGGGG - Exonic
1198215288 X:134549711-134549733 AGCGGGGCCACCGGGGGGCGGGG - Intergenic