ID: 1122500387

View in Genome Browser
Species Human (GRCh38)
Location 14:102194236-102194258
Sequence CTTATCGAGGCCATAATCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 52}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122500387_1122500393 9 Left 1122500387 14:102194236-102194258 CCTTTGATTATGGCCTCGATAAG 0: 1
1: 0
2: 0
3: 1
4: 52
Right 1122500393 14:102194268-102194290 CCGAAACCTAATCCAGAAGAGGG 0: 1
1: 0
2: 7
3: 140
4: 601
1122500387_1122500397 26 Left 1122500387 14:102194236-102194258 CCTTTGATTATGGCCTCGATAAG 0: 1
1: 0
2: 0
3: 1
4: 52
Right 1122500397 14:102194285-102194307 AGAGGGATTTTGACCCAGGAAGG 0: 1
1: 0
2: 6
3: 45
4: 280
1122500387_1122500398 27 Left 1122500387 14:102194236-102194258 CCTTTGATTATGGCCTCGATAAG 0: 1
1: 0
2: 0
3: 1
4: 52
Right 1122500398 14:102194286-102194308 GAGGGATTTTGACCCAGGAAGGG 0: 1
1: 0
2: 0
3: 22
4: 182
1122500387_1122500391 8 Left 1122500387 14:102194236-102194258 CCTTTGATTATGGCCTCGATAAG 0: 1
1: 0
2: 0
3: 1
4: 52
Right 1122500391 14:102194267-102194289 CCCGAAACCTAATCCAGAAGAGG 0: 1
1: 0
2: 0
3: 5
4: 76
1122500387_1122500396 22 Left 1122500387 14:102194236-102194258 CCTTTGATTATGGCCTCGATAAG 0: 1
1: 0
2: 0
3: 1
4: 52
Right 1122500396 14:102194281-102194303 CAGAAGAGGGATTTTGACCCAGG 0: 1
1: 0
2: 3
3: 43
4: 376

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122500387 Original CRISPR CTTATCGAGGCCATAATCAA AGG (reversed) Intronic
900834076 1:4986437-4986459 CTTGTCGAGGCCATGAAAAATGG - Intergenic
900845263 1:5093848-5093870 CTGATAAAGGCCTTAATCAAAGG + Intergenic
909103053 1:71375128-71375150 ATTTTCTATGCCATAATCAAGGG + Intergenic
911814063 1:102321516-102321538 CTTTTCCAGACCATAATGAAAGG + Intergenic
919400116 1:197103728-197103750 CTTTTAGAGGCTATAATAAAAGG - Exonic
923206038 1:231759836-231759858 CTTATTGAGGCCATGACTAAGGG - Intronic
1067142057 10:43666481-43666503 CTCATGGGGGCCATAGTCAAGGG + Intergenic
1081225477 11:40516958-40516980 CTTATATAGGCCAGAATGAAAGG + Intronic
1092702443 12:11247301-11247323 ATTATTGAGCCCATATTCAATGG + Intergenic
1101131301 12:101693897-101693919 CTTCTGAAGGCCATGATCAAAGG - Intergenic
1106432042 13:29690137-29690159 TTTATAGAGGCCACACTCAATGG + Intergenic
1109945307 13:69424176-69424198 CTTATCGCAGCCAAAAACAAAGG + Intergenic
1110998550 13:82145966-82145988 CTTCTCGAGGCCAAAATAATTGG + Intergenic
1115070666 14:29318382-29318404 CTTATAGAGGTCAGAGTCAATGG + Intergenic
1119672400 14:76529561-76529583 CATAACGAGGCTTTAATCAATGG + Intergenic
1122500387 14:102194236-102194258 CTTATCGAGGCCATAATCAAAGG - Intronic
1136640991 16:31564933-31564955 CTTATTGAGGCCATGATGAGTGG - Intergenic
1137019291 16:35407503-35407525 CTTATTGAGGCCCTAATGAGTGG - Intergenic
1139382496 16:66542297-66542319 CTTAACGAGAGCTTAATCAATGG + Intronic
1146053679 17:29570646-29570668 CTTATCGTGGCCATATTCTCCGG + Intronic
926643882 2:15267317-15267339 CTTATTCAGGCCAGAATCAAAGG + Intronic
930722942 2:54655483-54655505 CTGATCTAGGGCATAGTCAATGG - Intronic
931989297 2:67773675-67773697 CTTAATGATGCCATAATCTAGGG + Intergenic
932095228 2:68841342-68841364 GTGATCAAGGACATAATCAAAGG - Intergenic
942437416 2:175995461-175995483 CTATTCAAGGCTATAATCAAAGG + Intronic
944075883 2:195730199-195730221 CTTAGCGATGCCATGGTCAATGG - Intronic
1178275858 21:31236327-31236349 CTAATCCATGCCAAAATCAAAGG + Intronic
955880404 3:63538529-63538551 CTTACCAAGCCCAAAATCAATGG - Intronic
957112780 3:75987291-75987313 CTTTTTGATGCTATAATCAATGG + Intronic
962429889 3:135309277-135309299 ATTATGGAGGGCATAATCCAGGG + Intergenic
964236036 3:154529158-154529180 CTTCTCGAGGCCAAAGTGAATGG + Intergenic
972091172 4:35286034-35286056 CTTAAGGAGGACAGAATCAAGGG - Intergenic
991112019 5:62911047-62911069 TTTATCCAGTCCATCATCAATGG + Intergenic
991211784 5:64113840-64113862 CTTTTTGAGGTCATCATCAATGG - Intergenic
992368135 5:76114196-76114218 CTTCTAGAGGCCACAAGCAAGGG + Intronic
994619631 5:102147608-102147630 CTTAACTTGGCCATAATGAACGG - Intergenic
999259850 5:150231323-150231345 CTGATTGAAGCCATAAGCAATGG - Exonic
1009740501 6:67737430-67737452 CTTATCTAAGCCATAAGGAAAGG - Intergenic
1015011633 6:128356314-128356336 CTTATTGAAGGTATAATCAACGG + Intronic
1019970633 7:4537983-4538005 GTTAGCGAGGACAGAATCAAAGG + Intergenic
1020879025 7:13735715-13735737 CTTATTAAGGCCAACATCAATGG + Intergenic
1023861725 7:44220844-44220866 CTCATCGAGGCCGTCAACAACGG - Exonic
1034860473 7:154590897-154590919 CTTGTCGAGGCCATCATTATGGG - Intronic
1039143875 8:34423416-34423438 CTTATGTGGGCCATTATCAAAGG - Intergenic
1043222317 8:77682431-77682453 CTGGTAGATGCCATAATCAAAGG - Intergenic
1044863818 8:96549739-96549761 CTTATTGAGTCCCTAAACAAAGG - Intronic
1050905839 9:11004315-11004337 CTTATCCATGCCCTCATCAAGGG - Intergenic
1061315139 9:129790726-129790748 CTCGTCGAGGCCATCATAAATGG - Intergenic
1193787812 X:85781882-85781904 TTTATCCAGTCCATAATTAATGG - Intergenic
1194132658 X:90100944-90100966 TTTATCCAGTCTATAATCAATGG + Intergenic
1194341375 X:92710341-92710363 CTTATTGAAGCCATGATCCAGGG - Intergenic
1195757458 X:108213464-108213486 CTTATCAATACCATAACCAAGGG + Intronic
1200478445 Y:3671023-3671045 TTTATCCAGTCTATAATCAATGG + Intergenic
1200649726 Y:5827053-5827075 CTTATTGAAGCCATGATCCAGGG - Intergenic