ID: 1122500391

View in Genome Browser
Species Human (GRCh38)
Location 14:102194267-102194289
Sequence CCCGAAACCTAATCCAGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 76}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122500388_1122500391 -5 Left 1122500388 14:102194249-102194271 CCTCGATAAGTAATGTTCCCCGA 0: 1
1: 0
2: 0
3: 2
4: 67
Right 1122500391 14:102194267-102194289 CCCGAAACCTAATCCAGAAGAGG 0: 1
1: 0
2: 0
3: 5
4: 76
1122500387_1122500391 8 Left 1122500387 14:102194236-102194258 CCTTTGATTATGGCCTCGATAAG 0: 1
1: 0
2: 0
3: 1
4: 52
Right 1122500391 14:102194267-102194289 CCCGAAACCTAATCCAGAAGAGG 0: 1
1: 0
2: 0
3: 5
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122500391 Original CRISPR CCCGAAACCTAATCCAGAAG AGG Intronic
902188204 1:14741218-14741240 CCTGTGACATAATCCAGAAGAGG + Intronic
908424132 1:63988991-63989013 CCCAAAAGCAATTCCAGAAGTGG + Intronic
910855396 1:91690075-91690097 GCCGAAACCTAAGCCAACAGTGG + Intronic
911999331 1:104810950-104810972 CCTGAAACCAAAACCAGGAGAGG - Intergenic
919101605 1:193103927-193103949 CCTGAAGCCTAAACCAGAAAAGG + Intronic
1065091357 10:22237287-22237309 CCCGATACCAAAACCAGAAAAGG - Intergenic
1067475655 10:46564218-46564240 TGGGAAACCTCATCCAGAAGAGG - Intergenic
1067619081 10:47777557-47777579 TGGGAAACCTCATCCAGAAGAGG + Intergenic
1076244794 10:128938451-128938473 CCCGTGACCTCATCCTGAAGGGG - Intergenic
1077667122 11:4122171-4122193 CCCCAAACCTCATCCAGACCAGG - Exonic
1078825482 11:14926047-14926069 CCTGAAATCTAAGACAGAAGAGG + Intronic
1090428053 11:126623871-126623893 CCCCAACCCCAGTCCAGAAGGGG + Intronic
1092382277 12:8006662-8006684 GCCAAAGCCTAATCCAGAGGAGG + Intergenic
1096745609 12:53725052-53725074 CCATAAACCTAAGCCAAAAGGGG + Intronic
1111033938 13:82645242-82645264 CCCGACATCTAACACAGAAGCGG + Intergenic
1113026445 13:105946133-105946155 CCAGAAACCTGCTCCAGAAGTGG - Intergenic
1118574095 14:67224133-67224155 CCCAAAACCTTATGCAGAAAAGG - Intronic
1122500391 14:102194267-102194289 CCCGAAACCTAATCCAGAAGAGG + Intronic
1123011508 14:105351990-105352012 CTCAAAACCAAAACCAGAAGAGG + Intronic
1123886978 15:24735916-24735938 CCCAAAACCTAATCCCACAGAGG - Intergenic
1127657113 15:61066010-61066032 CCCAAACCCTAGCCCAGAAGAGG - Intronic
1130403858 15:83580864-83580886 CCCCCAACCTCATCCACAAGAGG + Intronic
1137637020 16:49995785-49995807 CCCCAAACCCAATCCAGACCTGG + Intergenic
1142089886 16:88204194-88204216 CCCGTAACCTCATAGAGAAGCGG + Intergenic
1148858930 17:50593939-50593961 CCTGAAACCTTACCCAGGAGAGG - Intronic
1154533796 18:15375860-15375882 CCCGGTACCTAACCCAGCAGGGG - Intergenic
1155061591 18:22233510-22233532 CGCTAAACCTAACCCAGGAGAGG - Intergenic
1156687949 18:39672738-39672760 CCAGAAAATTAATCCAGTAGAGG - Intergenic
1157917704 18:51683932-51683954 CCCGATACCTAAACCAGACAAGG + Intergenic
1157955337 18:52090716-52090738 CACTAAACCTAATCTAGTAGTGG - Intergenic
1159124666 18:64208715-64208737 CCTGAGATCTTATCCAGAAGCGG - Intergenic
1159333985 18:67039450-67039472 CCCAAAACATTATCCAGATGTGG - Intergenic
1166729955 19:45053339-45053361 CCCTATACCAAATCTAGAAGGGG - Intronic
1166814352 19:45533593-45533615 GCCGGATCCTAATCCAGGAGAGG + Intronic
926282417 2:11460923-11460945 CCAGAAACCTAATACAGATTTGG + Intronic
927980319 2:27370759-27370781 CCCGAAACCGAGTCCCGCAGCGG + Exonic
929529727 2:42741230-42741252 CCCAAAGCCTAATCCAGAGCAGG - Intronic
929889386 2:45906619-45906641 CCCCCAACCTAACCCAGCAGAGG - Intronic
933482314 2:82872977-82872999 CCTGATACCAAATCCAGAAAAGG - Intergenic
935534190 2:104274000-104274022 CCTGGAACCTAATGGAGAAGTGG - Intergenic
942779244 2:179621727-179621749 CCCAAAACATAATCCCAAAGGGG - Intronic
948562449 2:238863703-238863725 CCCGAACCCAAATTGAGAAGAGG + Intronic
1173398614 20:42704171-42704193 GAGGAAACCTAATCTAGAAGGGG - Intronic
1176911724 21:14573553-14573575 CCCTAAACCTAAACCAGCTGAGG + Intronic
1182407689 22:30151115-30151137 CAAGAAACCTAAACCAGCAGTGG - Intronic
1182889611 22:33806295-33806317 ACCGAAACCAAAACCAGAAGTGG + Intronic
951059431 3:18188009-18188031 ACAGAAACCTAGTCCAGAAAGGG + Intronic
955949933 3:64232881-64232903 CCTGACATCTAATCCAGAGGAGG + Intronic
961057664 3:123802875-123802897 CCCCAAACTTAATCCTGAGGGGG - Intronic
971355288 4:25889864-25889886 CCAACACCCTAATCCAGAAGAGG + Intronic
973652110 4:53006681-53006703 CCCTAAACCTAATCTAGCTGGGG + Intronic
974710852 4:65592640-65592662 CCCGAAACCTCACCCAGAGAAGG - Intronic
976615679 4:87073549-87073571 ACCAACACCTACTCCAGAAGAGG + Intronic
979763920 4:124441911-124441933 CCTGAAACCAAATCCAGACAAGG - Intergenic
980610464 4:135154140-135154162 CCTGATACCAAATCCAGAAAAGG - Intergenic
985428849 4:189858326-189858348 TCCTAAAACTAAACCAGAAGGGG + Intergenic
986028482 5:3872898-3872920 CCAGAAGCCCAATCCAGAAGAGG + Intergenic
993931497 5:93947325-93947347 CCCAGACCCTAACCCAGAAGTGG - Intronic
996381229 5:122864293-122864315 CCCCAAATCTAATCCATCAGTGG - Intronic
1003979931 6:11380070-11380092 CTCCAAGCCAAATCCAGAAGAGG + Intronic
1008885022 6:56423338-56423360 CCCTAAACCTAGTCCTGATGGGG - Intergenic
1008925766 6:56891062-56891084 CACCTAACCAAATCCAGAAGAGG + Intronic
1010693103 6:78933737-78933759 GCCAAAACCTAATCCAGAGAAGG - Intronic
1013608240 6:111770808-111770830 CTCGAGATCTAATCCAGAATTGG + Intronic
1014010871 6:116473989-116474011 TCTGAAACCTAAGCCAGAAGTGG + Intergenic
1016848035 6:148588419-148588441 GCCAAAGCCTAATCCAGAACAGG + Intergenic
1020490415 7:8776191-8776213 CCCGAAAGTTATTCCACAAGTGG + Intergenic
1020713795 7:11643183-11643205 TCCATAACCAAATCCAGAAGGGG - Intronic
1029537509 7:101164973-101164995 CCCCAAACCTTACCCAGAAGAGG + Intronic
1043093441 8:75933591-75933613 CATGAAACCGAATCTAGAAGTGG - Intergenic
1045667045 8:104499365-104499387 AATGAAACCTAATCCAGATGTGG + Exonic
1049238690 8:141525636-141525658 CCTGAAATGCAATCCAGAAGCGG + Intergenic
1051805782 9:20991023-20991045 CCCCACCCCTACTCCAGAAGAGG - Intronic
1051945030 9:22558077-22558099 ACCCAAACCTAATCCAGAGTAGG - Intergenic
1052003916 9:23323438-23323460 CCCCAAACCTCATCCAGTGGGGG - Intergenic
1059559873 9:115323944-115323966 GAGGAAATCTAATCCAGAAGTGG + Intronic
1186809985 X:13178923-13178945 CCTGAAGCCTAACCCAGCAGAGG - Intergenic
1190318578 X:49166198-49166220 CCCGGAGCCTAGTCCAGAGGCGG + Exonic
1190595101 X:52044395-52044417 CCAGAAACCAAAGGCAGAAGAGG + Intergenic
1190613723 X:52209678-52209700 CCAGAAACCAAAGGCAGAAGAGG - Intergenic
1194337829 X:92669897-92669919 CCTGATACCTAAACCAGAAAAGG + Intergenic
1197142094 X:123129294-123129316 CCAAAAAGCTAATCCAGCAGTGG + Intergenic