ID: 1122500393

View in Genome Browser
Species Human (GRCh38)
Location 14:102194268-102194290
Sequence CCGAAACCTAATCCAGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 749
Summary {0: 1, 1: 0, 2: 7, 3: 140, 4: 601}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122500387_1122500393 9 Left 1122500387 14:102194236-102194258 CCTTTGATTATGGCCTCGATAAG 0: 1
1: 0
2: 0
3: 1
4: 52
Right 1122500393 14:102194268-102194290 CCGAAACCTAATCCAGAAGAGGG 0: 1
1: 0
2: 7
3: 140
4: 601
1122500388_1122500393 -4 Left 1122500388 14:102194249-102194271 CCTCGATAAGTAATGTTCCCCGA 0: 1
1: 0
2: 0
3: 2
4: 67
Right 1122500393 14:102194268-102194290 CCGAAACCTAATCCAGAAGAGGG 0: 1
1: 0
2: 7
3: 140
4: 601

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122500393 Original CRISPR CCGAAACCTAATCCAGAAGA GGG Intronic
901042308 1:6372280-6372302 CCAAAGCCTAATCCAGAGCAAGG - Intronic
901289201 1:8109560-8109582 CCGATGCCTAATCCAGAGCAGGG + Intergenic
902275015 1:15333283-15333305 CCCAGAGCTAATCCAGAAGGAGG + Intronic
903636069 1:24817497-24817519 CCAAAACCTAATCCAGATCAAGG - Intronic
904127717 1:28253364-28253386 CCAAAACCTAATCCAGAGCAAGG + Intergenic
904863017 1:33553919-33553941 CCAAAGCCTAATCCAGAGCAAGG + Intronic
905086107 1:35378992-35379014 CCAAAGCCTAATCCAGAGCAAGG - Intronic
905144254 1:35874892-35874914 CCAAAGCCTAATCCAGAGCAAGG + Intronic
905334693 1:37236435-37236457 ATGAAACCTAATTGAGAAGAAGG + Intergenic
905545850 1:38800070-38800092 CCAAAGCCTAATCCAGAGCAAGG - Intergenic
905772733 1:40648888-40648910 CCCAAACCTAATCCAGCACCAGG + Intronic
906269809 1:44467578-44467600 CCAAAGCCTAATCCAGACCAAGG - Intronic
906558810 1:46738374-46738396 CAAAAACCTAATCCAGAGCAAGG - Intergenic
906838893 1:49114377-49114399 CCAAAGCCTAATCCAGATCAAGG - Intronic
907002055 1:50871107-50871129 CCAAAACCTAATGCAGAGCAAGG + Intronic
907628068 1:56050969-56050991 CCAAACCCTAATCCAGAGCAAGG - Intergenic
907685105 1:56603045-56603067 CCAAAGCCTAATCTAGAACATGG + Intronic
909029101 1:70517727-70517749 CCAAAGCCTAATCCAGAGCAAGG + Intergenic
910163192 1:84296216-84296238 CCAAAGCCTAATCCAGAGCAAGG - Intergenic
910269852 1:85382309-85382331 CCAAAGCCTAATCCAGAGCAAGG + Intronic
910640106 1:89451302-89451324 CCCAACCCTAATCCAGAACAAGG + Intergenic
910855398 1:91690076-91690098 CCGAAACCTAAGCCAACAGTGGG + Intronic
911296643 1:96125586-96125608 CTGAAGCCTAATCCAGAGCAAGG + Intergenic
911559563 1:99388102-99388124 CCAAAGCCTAATCCAGAGCAAGG + Intergenic
911868390 1:103058291-103058313 CCGCAGCTTAATCCAGAACAAGG - Intronic
911896999 1:103448786-103448808 CCTAAACCTAATCCAGAGTAAGG - Intergenic
911969880 1:104418949-104418971 CTAAAGCCTAATCCAGAACAAGG - Intergenic
912902480 1:113667487-113667509 CCAAAGCCTAATCCAGAGCAAGG - Intronic
913307656 1:117449819-117449841 CCAAAGCCTAATGCAGAGGAAGG + Intronic
914356890 1:146894107-146894129 CCAAAGCCTAATCCAGAACAAGG - Intergenic
914415186 1:147473827-147473849 CCAAAGCCTAACCCAGAGGAAGG + Intergenic
914737845 1:150435594-150435616 CCAAAGCCTAATCCAGAGCAAGG + Intronic
914774540 1:150724378-150724400 CCGAAGTCTAATCCAGAGCAAGG - Intergenic
914776405 1:150739805-150739827 CGAAAACCTAATCCAGAGCAAGG + Intronic
914977185 1:152377560-152377582 CCAAAGCCTAATCCAGAACAAGG + Intergenic
916191543 1:162183770-162183792 CCAAAGCCTAATCCAGAGCAAGG - Intronic
916304245 1:163311237-163311259 CCAAAGCCTAATCCAGAGCAAGG - Intronic
916553099 1:165868669-165868691 CCAAAGCCTAATCCAGAGCAAGG - Intronic
916993577 1:170271027-170271049 CCCAAACCTAATCTAAATGATGG + Intergenic
917238933 1:172926047-172926069 CCAAAGCCTAATCCAGAGCAAGG - Intergenic
917669488 1:177259249-177259271 CCAAAGCCTAATCCAGAGTAAGG + Intronic
917766108 1:178219221-178219243 CCAAAGCCTAATCCAGAGCAAGG - Intronic
917861487 1:179149235-179149257 CCAAAGCCTAATCCAGAGCAAGG + Intronic
918392131 1:184076802-184076824 CCAAAACCTAATCCAGAGCAAGG + Intergenic
919054974 1:192559248-192559270 CCAAACCCTAATCCAGAGCAAGG - Intergenic
919217325 1:194575320-194575342 CCAAAACCTAATCTAGAGCAAGG + Intergenic
919288265 1:195594188-195594210 CCAAAGCCTAATCCAGAGCAAGG - Intergenic
919548868 1:198959478-198959500 CCAAAGCCTAATCCAGAGCAAGG - Intergenic
919612848 1:199767464-199767486 CCAAAACCTAATCCAGAGCAAGG + Intergenic
920024316 1:202981936-202981958 CCAAAGCCTAATCCAGAGCAAGG - Intergenic
920064205 1:203254692-203254714 CCAAAGCCTAATTCAGAACAAGG + Intronic
920662728 1:207931176-207931198 CCAAACCCTACTCCAGAACAAGG - Intergenic
920799746 1:209174797-209174819 CCAAAGCCTAATCCAGAGCAAGG + Intergenic
920930059 1:210379575-210379597 CCCAAACCCAGTCCAAAAGAAGG - Intronic
921282041 1:213577009-213577031 CCAAAGCCTAATCCAGAGAAAGG + Intergenic
921571753 1:216787933-216787955 CCAAAGCCTAATCCAGAGCAAGG + Intronic
921908179 1:220517603-220517625 CCAAAACCTAATTCAGAGCAAGG + Intergenic
922065446 1:222134729-222134751 CCGAAACCTACTCCAGAGCAAGG - Intergenic
922659026 1:227413104-227413126 CCAAAACCCAATCCAGAGCAAGG - Intergenic
922903105 1:229153481-229153503 CCAAAACCTAACCCAGAACAAGG - Intergenic
923014665 1:230117236-230117258 CCAAAGCCTAATCCAGAGCAAGG - Intronic
923456343 1:234168761-234168783 CAGAAACCTAACCGTGAAGAGGG + Intronic
924080671 1:240394354-240394376 CCAAAGCCTAATCCAGAGCAGGG + Intronic
924168649 1:241313014-241313036 CCAAACCCTAATCCAGAACAAGG + Intronic
924397142 1:243632909-243632931 CCAAAGCCTAATCCAGAGCAAGG - Intronic
924409637 1:243790468-243790490 CCAAAGCCTAATCCAGAGGCAGG - Intronic
1062777193 10:161780-161802 CCAAAACCTAATCCAGAACAAGG - Intronic
1062897178 10:1112743-1112765 CCAAAGCCTAATCCAGAGCAGGG + Intronic
1063236588 10:4123222-4123244 CCAAAGGCTAATCCAGAGGAAGG + Intergenic
1063536049 10:6884411-6884433 CCGAATCCTAACCCAGATGATGG - Intergenic
1064949980 10:20837379-20837401 ACCAAACCTAATCCAGAACAAGG + Intronic
1065546486 10:26826861-26826883 CCAAAGCCTAATTCAGAACAAGG - Intronic
1065899593 10:30193665-30193687 CCAAAACCTCATCCAGAGCAAGG + Intergenic
1066531223 10:36341945-36341967 CCAAACCCTAATCCAGAGCAAGG + Intergenic
1067475654 10:46564217-46564239 GGGAAACCTCATCCAGAAGAGGG - Intergenic
1067508945 10:46879088-46879110 CAGAAACCTATTCCATGAGATGG - Intergenic
1067619082 10:47777558-47777580 GGGAAACCTCATCCAGAAGAGGG + Intergenic
1067653307 10:48172762-48172784 CAGAAACCTATTCCATGAGATGG + Intronic
1068122603 10:52798684-52798706 CCAAACCCAAATCCAGCAGAAGG - Intergenic
1068127122 10:52854160-52854182 CCAAAGCCCAATCCAGAACAAGG + Intergenic
1068269011 10:54695306-54695328 CCAAAGCCTAATCCAGAACAAGG + Intronic
1068870090 10:61934210-61934232 CCAAAGCCTAATCCAGAGCAGGG - Intronic
1069207487 10:65710057-65710079 CCAAAGCCTAATCCAGAGCAAGG - Intergenic
1070315480 10:75307343-75307365 CCAAAGCCTAATCCAGAGCAAGG + Intergenic
1070420762 10:76234806-76234828 CCAAAGCCTAATCCAGAGCAAGG - Intronic
1071364667 10:84886289-84886311 CCTAAGCCTAATCCAGAGAAAGG - Intergenic
1072166659 10:92820098-92820120 CCAAACCCTAATCCAAAACAAGG - Intergenic
1072601010 10:96929496-96929518 CCAAAGCCTAATCCAGAGCAAGG - Intronic
1072889667 10:99311995-99312017 CCAAAGCCTAATCCAGAGCAAGG + Intergenic
1073598954 10:104827986-104828008 CCAAAGCCTAATCCAGAGCAAGG - Intronic
1074090936 10:110254743-110254765 CCAAAGCCTAATCCAGAGCAAGG + Intronic
1074691493 10:116009088-116009110 CCGAAGCCTAATCCAGAGCAAGG + Intergenic
1075168257 10:120088915-120088937 CCAAAGCCTAATCCAGAGCAAGG + Intergenic
1075178916 10:120192119-120192141 CCAAAGCCTAATCTAGAGGAAGG - Intergenic
1075841113 10:125504553-125504575 CCAAAGCCTAATCCAGAGCAAGG + Intergenic
1076205955 10:128603139-128603161 CTAAAGCCTAATCCAGAGGAAGG + Intergenic
1077824750 11:5794146-5794168 CCAAAACCTAATCTAGAGCAAGG + Intronic
1077911479 11:6575499-6575521 CCAAAGCCTAATCCAGGACAAGG - Intronic
1078117693 11:8470378-8470400 CCAAAGCCTAATCCAGAGCAAGG - Intronic
1079398187 11:20084083-20084105 CCAAAACCAAAACCAAAAGAAGG - Intronic
1079571673 11:21951579-21951601 CCAAAGCCTAACCCAGAACAAGG - Intergenic
1079758433 11:24296800-24296822 CCAAAGCCTAATCCAGAGTAAGG - Intergenic
1080902175 11:36505490-36505512 CCAAAACCTAATCCAGAGCAAGG - Intronic
1080940049 11:36906148-36906170 CCAAAGCCTAATCCAGAGCAAGG + Intergenic
1080948253 11:36998961-36998983 CCAAAACGTGATCAAGAAGAGGG + Intergenic
1081094160 11:38911227-38911249 CCAAACCCTAATCCAGAGCAAGG + Intergenic
1081485703 11:43526416-43526438 GCAAAACCTAATCCAGATCAAGG - Intergenic
1081652868 11:44836339-44836361 CCAAAGCCTAATCCAGAGAAAGG + Intronic
1082200004 11:49354985-49355007 CCAAAGACTAATCCAGAACAAGG - Intergenic
1085367140 11:75959524-75959546 CCAAAGCCTAATCCAGAGTAAGG - Intronic
1085441169 11:76564164-76564186 CCAAAACCTAATCCAGATCAAGG - Intergenic
1085633244 11:78137276-78137298 CCAAAACCTTATCCAGAGCAAGG - Intronic
1086273336 11:85094650-85094672 CCAAAGCCTAATCCAGAGCAAGG - Intronic
1086471578 11:87118903-87118925 CCAAAACCTAATCCAGAGCAAGG - Intronic
1086655670 11:89351213-89351235 CCAAAGACTAATCCAGAACAAGG + Intronic
1087421967 11:97940516-97940538 CCAAAGCCTAATCCAGAGCAAGG + Intergenic
1087665632 11:101044368-101044390 CCTAAGCCTCATCCAGAGGAAGG - Intronic
1087671244 11:101109514-101109536 GCCAAACCTAATCCAGAGCAAGG + Intronic
1087950530 11:104215225-104215247 CTGATACCTAAACCAGAATAAGG - Intergenic
1087977384 11:104565976-104565998 CCAAAACCTAATCCAGAGCAAGG + Intergenic
1088157015 11:106818858-106818880 CCAAAGCCTAATCCAGAGAAAGG + Intronic
1088266846 11:107996098-107996120 CCAAAGCCTAATCCAGAGCAAGG - Intergenic
1088518520 11:110666913-110666935 CCAAAGCCTAATCCAGAGCAAGG + Intronic
1088855953 11:113753770-113753792 CCAAAACCTAATCCAGAGCAAGG + Intronic
1090260845 11:125318484-125318506 CCAAAGCCTAATCCAGAGCAAGG - Intronic
1091515549 12:1177130-1177152 CCAAAGCCTAATCCAGAACAAGG - Intronic
1092026501 12:5245149-5245171 CAGAACCCCAATCCAGAAGAAGG - Intergenic
1092364568 12:7866323-7866345 CCAAAGCCTAATCCAGAGCAAGG + Intronic
1092382279 12:8006663-8006685 CCAAAGCCTAATCCAGAGGAGGG + Intergenic
1092966121 12:13644885-13644907 CCAAAGCCTAATTCAGAGGAAGG - Intronic
1093252574 12:16825544-16825566 CCAAAGCCTAATCCAGAGCAAGG + Intergenic
1093375056 12:18415840-18415862 CCAAAGCCTAATCCAGAGCAAGG + Intronic
1093435112 12:19127974-19127996 CCAAAGCCTAATCCAGAGCAAGG - Intergenic
1093575193 12:20719646-20719668 CCAAAACCTAATTCAGAACAAGG + Intronic
1093686990 12:22068013-22068035 CCAAAGCCTAATCCAGAGCAAGG - Intronic
1093823220 12:23647783-23647805 CCAAAGCCTAATCCAGAGGAAGG - Intronic
1093838334 12:23864631-23864653 CCAAACCCTAATCCAGAACAAGG + Intronic
1094059206 12:26295514-26295536 CCAAAGCCTAATCCAGAGCAAGG - Intronic
1094205390 12:27834262-27834284 CCAAAGCCTAATCTAGAAGAAGG + Intergenic
1094250372 12:28353224-28353246 CCAAAGCCTAATTCAGAACAAGG - Intronic
1094440142 12:30466181-30466203 CCAAAGCCTAATCCAAAACAAGG - Intergenic
1094635518 12:32223551-32223573 CCAAAGCCTAATCCAGAGCAAGG - Intronic
1095754560 12:45749861-45749883 CCAAAGCCTAATCCAGAACAAGG - Intronic
1095764137 12:45875829-45875851 CCAAAGCCTAATCCAGAGCAAGG - Intronic
1095791193 12:46169208-46169230 CCAAAGCCTAATCCAGAGAAAGG - Intergenic
1097788533 12:63788648-63788670 CCAAAGCCTAATCCAGAGCAAGG - Intronic
1098800617 12:74952907-74952929 CCAAAGCTTAATCCAGAACAAGG - Intergenic
1098975547 12:76898332-76898354 CAGAAAATTAATCCAAAAGAGGG + Intergenic
1099595720 12:84662618-84662640 CCAAAGCCTAATCCAGAACTAGG - Intergenic
1100516405 12:95332399-95332421 CCAAAGCCTAATCCAGAGCAAGG - Intergenic
1100695599 12:97089343-97089365 CCAAAGCCTAATCCAGAGCAAGG - Intergenic
1100940917 12:99721990-99722012 CCAAATGCTAATCCAGAACAAGG + Intronic
1101483243 12:105123525-105123547 CCAAAGCCTAATCCAGAGCAAGG + Intronic
1104165174 12:126221394-126221416 CCAAAGCCTAATCCAGAGCAAGG + Intergenic
1104395772 12:128431241-128431263 CCAAAGCCTAATCCAGAGCATGG + Intronic
1104488387 12:129172251-129172273 CCAAAGCCTAATCCAGAGCAAGG - Intronic
1105337686 13:19488665-19488687 CCAAAGCCTAATCCAGGACAAGG - Intronic
1105589675 13:21779848-21779870 CCAAAACCCAATCCAGAGCAAGG + Intergenic
1105868270 13:24480672-24480694 CCAAAGCCTAATCCAGAGCAAGG + Intronic
1106456542 13:29932766-29932788 CCGAAGCCTAATCCAGAGGAAGG - Intergenic
1108632977 13:52304063-52304085 CCAAAGCCTAATCCAGGACAAGG - Intergenic
1108653714 13:52508492-52508514 CCAAAGCCTAATCCAGGACAAGG + Intergenic
1108770653 13:53696619-53696641 CCAAAGCCTCATCCAGAACAAGG + Intergenic
1108787529 13:53923411-53923433 CAGAAAGCAAATGCAGAAGACGG - Intergenic
1108926491 13:55753704-55753726 CCAAAGCCTAATCCAGAGCAAGG + Intergenic
1109125991 13:58517530-58517552 CCAAAGCCTAATCTAGAATAAGG + Intergenic
1109265821 13:60199116-60199138 CCAAAGCCTAATCCAGAGCAAGG - Intergenic
1109681842 13:65762119-65762141 GCTAAACCTAATCCAGACCAAGG - Intergenic
1109984796 13:69965845-69965867 CCAAAGCCTAATCCAGAGTAAGG + Intronic
1110379019 13:74828286-74828308 CCAAAGCCTAATCCAGAGCAAGG + Intergenic
1110382482 13:74869656-74869678 CCAAAGCCTAATCCAGAGAAAGG - Intergenic
1110766530 13:79285529-79285551 CCAAAGCCTAATCCAGAGAAAGG + Intergenic
1110866425 13:80401020-80401042 CCAAAGCCTAATCCAGAGCAAGG - Intergenic
1111487086 13:88917925-88917947 CCAAAACCTAATCCAGAGCAAGG - Intergenic
1112116152 13:96357113-96357135 ACAAAGCCTAATCCAGAACAAGG - Intronic
1113200506 13:107863674-107863696 CAAAAACATAATCCAGAAGTAGG + Intronic
1113304407 13:109061146-109061168 CCAAAGCCTAATCCAGAGAAAGG - Intronic
1113649019 13:112021180-112021202 CCAAAGCCTAATCCAGAGCAAGG + Intergenic
1114591999 14:23874401-23874423 CCAAAGCCTAATCCAGAGAAAGG - Intergenic
1114734317 14:25027922-25027944 CCAAAGCCTAATCCAGAGAAAGG + Intronic
1115013089 14:28574055-28574077 CCAAAGCCTAATCCAGAACAAGG - Intergenic
1115043685 14:28962381-28962403 CCAAAGCCTAATCCAGAGCAAGG - Intergenic
1115109960 14:29809679-29809701 CCAAATCCTAATCCAGAGTAAGG - Intronic
1115379122 14:32713728-32713750 GCCAAACCTAATTCAGAGGAAGG - Intronic
1115395472 14:32903716-32903738 AGGAAAACAAATCCAGAAGATGG - Intergenic
1115419060 14:33171587-33171609 CCAAAACCTAATCCAGAGCAAGG - Intronic
1115627870 14:35213128-35213150 CCAAAACGTAATCCAGAGCAAGG - Intronic
1115803003 14:37016942-37016964 CCAAAAGCTAATCCAGAGCAAGG - Intronic
1115891523 14:38035043-38035065 CCAAAGCCTAATCCAGAGCAAGG - Intronic
1116091699 14:40315941-40315963 ACAAAGCCTAATCCAGAGGAAGG + Intergenic
1116476163 14:45342252-45342274 CCAAAGCCTAATCCAGAGCAAGG - Intergenic
1116509202 14:45722729-45722751 CCAAAGCCTAATCCAGAGCAAGG + Intergenic
1116924977 14:50625205-50625227 CCAAAGCCTAATCCAGAGCAAGG + Intronic
1117820039 14:59638733-59638755 CCAAAGCCTAATCCAGACCAAGG - Intronic
1118527049 14:66657190-66657212 CCAAAACCTAATCCAGGGCAAGG + Intronic
1118534968 14:66752141-66752163 CCAAAGCCTAATTCAGAACAAGG - Intronic
1118656091 14:67950467-67950489 CCAAAGCCTAATCCAGAGCAAGG - Intronic
1118866734 14:69710290-69710312 CTGAAACCTAATCCAGCATTAGG - Intronic
1119068466 14:71555423-71555445 CCAAAGCCTAATCCAGAGCAAGG - Intronic
1119170598 14:72532752-72532774 CCAAAGCCTAATCCAGAGCAAGG + Intronic
1119883333 14:78119557-78119579 CCAAAGCCTAATCCAGACCAAGG - Intergenic
1120023770 14:79559049-79559071 CCAAAGCCTAACCCAGAACAAGG - Intronic
1121165611 14:91794102-91794124 CCAAAACCTAATCCAGAGCAAGG + Intronic
1121296283 14:92827876-92827898 CCGAAGCCTAATCCAGAGCAAGG + Intronic
1121705066 14:95986307-95986329 CCAAAGCCTAACCCAGAACAAGG - Intergenic
1121766566 14:96492399-96492421 CCAAAGCCTAATCCAGAGCAAGG - Intergenic
1121910420 14:97785717-97785739 CTTAAACCTAATCCAGAGCAAGG + Intergenic
1122500393 14:102194268-102194290 CCGAAACCTAATCCAGAAGAGGG + Intronic
1122734102 14:103825584-103825606 CCAAAGCCTAATCCAGAGCAAGG + Intronic
1124568884 15:30841585-30841607 CCAAAGCCTAATCCAGAGCAAGG - Intergenic
1125000468 15:34764971-34764993 CCAAAACCTAATCTAGAGCAAGG - Intergenic
1125099547 15:35895298-35895320 CCAGAACCTAATCCAGAGCAAGG - Intergenic
1125333501 15:38604955-38604977 CTGAAGTGTAATCCAGAAGAGGG - Intergenic
1125651929 15:41324368-41324390 CTAAAGCCTAATCCAGAACAAGG - Intronic
1125979591 15:43988260-43988282 CCAAAACCTAATACAGAGCAAGG + Intronic
1126011450 15:44306406-44306428 CCAAAGCCTAATCCAGAGCAAGG - Intronic
1126391738 15:48163342-48163364 CCAAAGCCTAATCCAGAGTAAGG + Intronic
1126828292 15:52572855-52572877 CCAAAGCCTAATCCAGAACAAGG + Intergenic
1127307698 15:57724114-57724136 CCAAAGCCTAATCCAGAGCAAGG + Intronic
1128173935 15:65537070-65537092 CCAAAGCCTAATCCAGAACAAGG + Intronic
1128848904 15:70930888-70930910 CCAAAGCCTAATCCAGAACAAGG - Intronic
1129499352 15:76020728-76020750 CCAAAGCCTAATCCAGAGCAAGG + Intronic
1130129754 15:81130145-81130167 CCAAAGCCTAATCCAGAACAAGG - Intronic
1130290399 15:82594480-82594502 CCAAAACTTAATCCAGAGGAAGG - Intronic
1131887316 15:96930582-96930604 CCAAAGCTTAATCCAGAGGAAGG - Intergenic
1131909860 15:97186595-97186617 CCGAAACCTAACCCAGAGTGAGG - Intergenic
1132475308 16:133101-133123 CCAAAGCCTAATCCAGAAAAAGG - Intronic
1136025638 16:27466847-27466869 CCAAAGCCTAATCCAGAGAAAGG + Intronic
1136594290 16:31236932-31236954 CCGAAGCCAAATCCAGAGCAAGG - Intergenic
1137022606 16:35443685-35443707 CCAAAGCCTAATCCAGAGCAAGG + Intergenic
1137416198 16:48283061-48283083 CCGAAACCTAGTCCAGAGCAAGG + Intronic
1137465858 16:48708574-48708596 CCAAAGCCTAATCCAGAGCAAGG + Intergenic
1137740416 16:50765808-50765830 CCAAAGCCTAATCCAGAGCAAGG + Intronic
1138255441 16:55554506-55554528 CCAAAGCCTAATCCAGAATAAGG - Intronic
1140493139 16:75357662-75357684 CCAAAGCCTAATCCAGAGTAAGG - Intronic
1140872268 16:79117865-79117887 CCAAAATCTAATCCAGAGCAAGG - Intronic
1142744770 17:1950332-1950354 CCCAAGTCTATTCCAGAAGACGG + Intronic
1143442890 17:6989189-6989211 ACCAAGCCTAATCCAGAACAAGG + Intronic
1144265706 17:13566727-13566749 CCAAAGCCTAATCCAGAGCAAGG + Intronic
1146154204 17:30506441-30506463 CCTAAGCCTAATCCAGAGCAAGG + Intronic
1146538766 17:33676553-33676575 CCAAAGCCTAATCCAGAGCAAGG + Intronic
1146578784 17:34017737-34017759 CCAAAGCCTAATCCAGAGCAAGG + Intronic
1146589414 17:34115720-34115742 AAGAAACATTATCCAGAAGAGGG - Intronic
1148858929 17:50593938-50593960 CTGAAACCTTACCCAGGAGAGGG - Intronic
1149726107 17:58896224-58896246 CCAAAGCCTAATCCAGAGCAAGG + Intronic
1149940892 17:60864515-60864537 CCAAAGCCTAATCCAGAGCAAGG - Intronic
1149972107 17:61229198-61229220 CCAAAGCCTAATCCAGAGCAAGG + Intronic
1150198698 17:63330136-63330158 CCAAAGCCTAATCCAGAGTAAGG + Intronic
1150468108 17:65412425-65412447 CTGAAGCCTAATCCAGAGGAAGG - Intergenic
1150644859 17:66971673-66971695 CCAAAACCTGAACCAGAAAAAGG + Intronic
1150866709 17:68858266-68858288 CCAAAGCCTAATCCAGAGCAAGG + Intergenic
1151393909 17:73807096-73807118 GCGAAACCTAATCACCAAGATGG - Intergenic
1151783540 17:76263772-76263794 TCAAACTCTAATCCAGAAGATGG + Intergenic
1151793054 17:76321945-76321967 CCAAAGCCTAATCCAGAGCAAGG + Intronic
1153287979 18:3473915-3473937 CCAAAGCCTAATCCAGAGCAAGG + Intergenic
1153492849 18:5667351-5667373 CCAAAACCTAACCCAGAGCAAGG - Intergenic
1153566383 18:6422349-6422371 CCAAAACCTGATCCAGAGTAAGG - Intergenic
1155580187 18:27296290-27296312 CCAAAGCCTAATCCAGAGCAAGG - Intergenic
1155824665 18:30424656-30424678 CCTTAGCCTAATCCAGAACAAGG + Intergenic
1155827399 18:30465042-30465064 CCAAAACCTAATCCATAGTAAGG - Intergenic
1156424459 18:36994878-36994900 CAGAAACCTAATTCACAAGTAGG - Intronic
1156851992 18:41739440-41739462 CTGAAGCCTAATCCAGAGCAAGG + Intergenic
1157917706 18:51683933-51683955 CCGATACCTAAACCAGACAAGGG + Intergenic
1158446258 18:57524603-57524625 CCAAAGCCTAATCCAGAACAAGG + Intergenic
1158978181 18:62731870-62731892 CCAAACCCTAATCCAGAGCAAGG + Intronic
1159191244 18:65045732-65045754 CCAAAGCCTAATCCAGAGTAAGG + Intergenic
1159332089 18:67008997-67009019 CTAAAACCTAATCCAGAGCAAGG - Intergenic
1159514465 18:69439712-69439734 CCAAAGCCGAATCCAGAACAAGG - Intronic
1160552101 18:79700483-79700505 CCAAAGCCTAATCCAGAGCAAGG + Intronic
1162264835 19:9563267-9563289 CCAAAACCTAATCCAGAGCAAGG + Intronic
1164290935 19:23868062-23868084 CCTAAAAATAGTCCAGAAGATGG + Intergenic
1165125052 19:33588608-33588630 CCAAAGCCTAATCCAGAGCAAGG + Intergenic
1165686573 19:37826531-37826553 CCTAAACCTAATCCAGAGCAAGG + Intergenic
1167626874 19:50596291-50596313 CCAAAGCCTAATCCAGAGCAAGG + Intergenic
1168652869 19:58104007-58104029 CCAAAGCCTAATCCAGAGCAAGG + Intronic
925104207 2:1275980-1276002 CCAAAGCCTAATCCAGAACAAGG + Intronic
925299777 2:2803422-2803444 CTAAAACCTAATCCAGAGCAAGG - Intergenic
925527913 2:4824081-4824103 CCAAAGCCTAATCCAGAGCAAGG + Intergenic
925606016 2:5661069-5661091 CCAAAGCCTAATCCAGAGCAAGG - Intergenic
926537909 2:14136290-14136312 TCAAAACCTAATCCAGAGCAAGG + Intergenic
926818511 2:16826402-16826424 CCAAAGCCTAATCCAGAACAAGG - Intergenic
926979175 2:18548968-18548990 CCAAAACCTAATTCAGAGCAAGG + Intergenic
927014354 2:18942056-18942078 CCAAAGCCTAATCCAGAGCAAGG - Intergenic
927755446 2:25704897-25704919 CCAAAGCCTAATCCAGACCAAGG + Intergenic
928852105 2:35760638-35760660 CCAAAGCCTAATCTAGAAGAAGG + Intergenic
929097461 2:38277479-38277501 CCAAAGCCTAATCCAGAGCAAGG - Intergenic
929473499 2:42220897-42220919 CCAAAGCCTAATCCAGAGCAAGG + Intronic
929520465 2:42645649-42645671 CCAAAGCCTAATCCAGAGCAGGG + Intronic
929529725 2:42741229-42741251 CCAAAGCCTAATCCAGAGCAGGG - Intronic
930991787 2:57664896-57664918 CCAAAACCTAATCCAGAGCAAGG - Intergenic
931141891 2:59468490-59468512 CCAAAACCTAATCCAGAGCAAGG - Intergenic
931498043 2:62833139-62833161 CCAAAGCCTAATCCAGATCAAGG + Intronic
932862448 2:75308380-75308402 CCAAAGCCTAATCCAGAGCAAGG + Intergenic
933465930 2:82651611-82651633 CCAAAACCTAATCCAGAGCAAGG - Intergenic
933630149 2:84646668-84646690 CCAAAGCCTAATCCAGATCAAGG + Intronic
933873619 2:86595764-86595786 CCAAAGCCTAATCCAGAGCAAGG + Intronic
934061683 2:88300204-88300226 CCAAAGCCTAATCCAGAGCAAGG + Intergenic
934127358 2:88909765-88909787 CCAAAGCCTAATCCAGAGGAAGG + Intergenic
936257027 2:110925590-110925612 CCAAAGCCTAATCCAGAACAAGG - Intronic
937110043 2:119358679-119358701 CCAAAGCCTAATCCAGAGGAAGG + Intronic
937328702 2:121008180-121008202 CCGAATCCAAATCCAAAAGCAGG - Intergenic
937767066 2:125673886-125673908 CCAAAGCCTAATCCAGAGCAAGG + Intergenic
937830311 2:126413248-126413270 CCAAAACCTAATCTAGAGCAAGG - Intergenic
938311494 2:130292023-130292045 CCAAAGCCTAATCCAGAGCAAGG - Intergenic
938606544 2:132899307-132899329 CCAAAACCTAATCCAGAGCAAGG - Intronic
938946952 2:136221341-136221363 CCAAAGCTTAATCCAAAAGAAGG + Intergenic
939284089 2:140106517-140106539 TCAAAACCTAATCCAGACCAAGG + Intergenic
939308929 2:140447516-140447538 CCAAAGCCTAATCCAGAGCAAGG - Intronic
939816505 2:146903738-146903760 CCAAAGCCTAATCCAGTAAATGG + Intergenic
940024053 2:149186353-149186375 CCAAAGCCTAATCCAGAGCAAGG + Intronic
940399890 2:153236093-153236115 CCAAAACCTAATCTAGAACAAGG + Intergenic
941013967 2:160333473-160333495 TCCAAACCACATCCAGAAGAAGG + Intronic
941056470 2:160795329-160795351 CCAACACCTAATCCAGAGTAAGG + Intergenic
941733050 2:168940440-168940462 GCCAAACCTAATTCAGAACAAGG + Intronic
941801835 2:169668285-169668307 CCAAAGCCTAATCCAGAATGAGG - Intronic
941974643 2:171389655-171389677 CCAAAGCCTAATCCAGAGCAAGG + Intronic
942238053 2:173931855-173931877 CCAAAGCCTAATCCAGAGCAAGG - Intronic
942302818 2:174578662-174578684 GATAAACCTAATCCAGAAAATGG - Intronic
942507803 2:176661921-176661943 CCAAAGTCTAATCCAGAACAAGG + Intergenic
942614846 2:177780808-177780830 CCAAAGCCTAATCCAGATCAAGG - Intronic
942695614 2:178640047-178640069 CCGAAACCAAAGCCCGAAGCAGG - Exonic
942822346 2:180129497-180129519 CTGAAACCTAATCCACAGCAAGG - Intergenic
942999288 2:182304291-182304313 CCAAAGCCTAATCCAGAGCAAGG - Intronic
943199145 2:184796656-184796678 CCAAAACCAAACCCAGCAGAAGG - Intronic
943957362 2:194209316-194209338 CCAAAATCTAATCCAGAAAAAGG + Intergenic
943985774 2:194616227-194616249 CCAAAGCCTAATCCAGAGCAAGG - Intergenic
944338525 2:198566710-198566732 CCAAAGCCTAATCCAGAGCAAGG + Intronic
945330423 2:208533329-208533351 CCAAAGCCTAATCCAGAACGAGG + Intronic
945413589 2:209542797-209542819 CCAAAGCCTAATCCAGAGAAAGG - Intronic
945666533 2:212750859-212750881 CCAAAACCTAATCCAAAGCAAGG + Intergenic
946063155 2:216962482-216962504 TCAAAACCTAATCCAGAGCAAGG + Intergenic
946086287 2:217176495-217176517 CCAAAGCCTAATCCAGAGCAAGG - Intergenic
946901318 2:224374718-224374740 ACAAAGCCTAATCCAGAACAAGG + Intergenic
947293845 2:228608185-228608207 CCATAACCAAATTCAGAAGAAGG - Intergenic
947468190 2:230373021-230373043 CCAAAGCCTAATCCAGAGTAAGG + Intronic
947636858 2:231684634-231684656 CCAACACCTGCTCCAGAAGAGGG + Intergenic
947786344 2:232824489-232824511 CCAAAGCCTAATCCAGAACAAGG + Intronic
948107179 2:235424001-235424023 CCAAAGCCTAATCCATAACAAGG + Intergenic
948182294 2:235991753-235991775 CCCAAATCTAATGAAGAAGAAGG + Intronic
948506515 2:238431366-238431388 CCAAAGCCTAATCCAGAGCAAGG - Intronic
948721137 2:239900750-239900772 CCAAAGCCTAATCCAGAGCAAGG + Intronic
948955079 2:241283172-241283194 CCAAAGCCTAATCCAGAGCAAGG + Intronic
1169032794 20:2424511-2424533 CCAAAGCCTAATCCAGAGCAAGG - Intronic
1169518435 20:6344323-6344345 CGAAAACCTAATCCAGAGCAAGG - Intergenic
1169756689 20:9050406-9050428 CCAAAACCTAACCCAGAGCAAGG - Intergenic
1170164418 20:13346509-13346531 GCGAAGCCAAATCCAGAAGATGG + Intergenic
1170642740 20:18169970-18169992 CCAAAGCCTAATCCAGAGTAAGG + Intronic
1171205521 20:23276520-23276542 CCAAAGCCTAATCCAGAGCAAGG + Intergenic
1171323776 20:24272202-24272224 CCAAAGCCTAATCCACAACAAGG - Intergenic
1172236256 20:33377526-33377548 CCAAAGCCTAATCCAGAGCAAGG - Intronic
1173107065 20:40147488-40147510 CCAAAGCCTAATCCAGAGCAAGG - Intergenic
1173315986 20:41943362-41943384 CAGAAACCTAATGAAGATGATGG + Intergenic
1173707329 20:45121357-45121379 CCAAAGCCTAATCCAGAGCAAGG - Intergenic
1173851962 20:46224172-46224194 ACGAAACCTAATGCAGAGGAAGG - Intronic
1174652593 20:52140520-52140542 CCAAAGCCTAATCCAGAGCAAGG + Intronic
1174745909 20:53062614-53062636 CCAAAGCCTAATCCAGAGCAAGG - Intronic
1176946074 21:14983362-14983384 CCAAAGCCTAATCCAGAGCAAGG + Intronic
1177335681 21:19723028-19723050 CCAAAGCCTAATCCAGAGCAAGG - Intergenic
1177807962 21:25893591-25893613 CCAAAGCCTAATCAAGAACAAGG + Intronic
1177869254 21:26550642-26550664 CCAAAGCCTAATCCAGAGCAAGG + Intronic
1178070709 21:28962944-28962966 CCAAAACCGAATCCAGAGCAAGG + Intronic
1178195941 21:30345191-30345213 CCAAAACCTAATCCAGGGGGAGG + Intergenic
1179429148 21:41307320-41307342 CCAAAGCCTAATCCAGAGCAGGG - Intronic
1179965118 21:44799597-44799619 CCAAAGCCTAATCCAGAGCAAGG - Intronic
1180651962 22:17385084-17385106 CCAAAGCCTAATCCAGAGCAAGG - Intronic
1182734690 22:32523985-32524007 CCAAAGCCTAATCCAGAGCAAGG + Intronic
1182889613 22:33806296-33806318 CCGAAACCAAAACCAGAAGTGGG + Intronic
1183234057 22:36603220-36603242 CCAAAGCCTAATCCAGAGTAAGG + Intronic
1183533270 22:38376143-38376165 CCAAAGCCTAATCCAGGACAAGG - Intronic
1183757919 22:39787633-39787655 CCAAAGCCTAATCCAGAGCAAGG + Intronic
1183764502 22:39859191-39859213 CCAAAGCCTAATCCAGAGCAAGG - Intronic
949623203 3:5839140-5839162 CCAAAACCCAATCCAGAGGAAGG - Intergenic
949984607 3:9530488-9530510 CCAAAGCCTAATCCAGAGCAAGG - Intronic
950551753 3:13670266-13670288 CCATCACCTAATGCAGAAGAAGG - Intergenic
950632452 3:14291962-14291984 CCAAAGCCTAATCCAGAGCAAGG + Intergenic
950928106 3:16763399-16763421 CCAAAACCTAATCCAAAGCAAGG - Intergenic
950957953 3:17074858-17074880 CCAAAGCCTAATCCAGAGCAAGG - Intronic
951306660 3:21071505-21071527 CCAAAGCCTAATCCAGAGCAAGG + Intergenic
951333076 3:21388598-21388620 CCAAAGCCTAATCCAGAGCAAGG + Intergenic
951506969 3:23457874-23457896 CCAAAACCTAATCCAGCGCAAGG - Intronic
951517476 3:23577420-23577442 CCAAAGCCTAATCCAGCATAAGG + Intronic
951530042 3:23690137-23690159 CCAAAGCCTAATCCAGAGCAAGG - Intergenic
952003642 3:28815424-28815446 CCAAAGCCTAATCCAGAGCAAGG - Intergenic
952015689 3:28954213-28954235 CCAAAACTTAATCCAGAGCAAGG + Intergenic
952410528 3:33046116-33046138 GCGAAACATCATCCAGAAGGTGG - Exonic
952593840 3:34989837-34989859 CCAAAGCCTAATCCAGAGCAAGG + Intergenic
952660251 3:35837446-35837468 CCCAAGCCTAATCCAGAGCAAGG - Intergenic
952806000 3:37352670-37352692 CCAAACCCTAATCCAGAGCAAGG - Intronic
952809999 3:37393480-37393502 CCAAAGCCTAATCCAGAGCAAGG + Intronic
953174516 3:40537676-40537698 CCAAAACCTAATCCAGAGCAAGG + Exonic
953367255 3:42355784-42355806 CCAAAACCTGATCCAGAGCAAGG + Intergenic
953486874 3:43308070-43308092 CCAAAACCTAATCCAGAGCAAGG + Intronic
955164487 3:56497525-56497547 CCAAAACCTAATCCAGGGCAAGG - Intergenic
955211197 3:56942885-56942907 CCAAAGCCTAATCCAGAGCAAGG + Intronic
955416575 3:58697493-58697515 CCAAAGCCTAATCCAGAGCAAGG - Intergenic
955426612 3:58797397-58797419 CCAAAGCCTAATCCAGAACAAGG + Intronic
955593571 3:60563699-60563721 CCAAAGCCTAATCCAGAGCAAGG + Intronic
956163097 3:66375140-66375162 CCAAAACCTAATCCAGAGCAAGG + Intronic
956960649 3:74396435-74396457 CCAAAGCCTAATCCAGAACAAGG + Intronic
957233556 3:77553706-77553728 CCAAAGCCTAATCCAGAGCAAGG + Intronic
957400911 3:79712413-79712435 CCAAAACCTAATCTAGAGCAAGG + Intronic
957809622 3:85203032-85203054 CCGAAACCTAATCCAGAGCAAGG - Intronic
957863696 3:85994350-85994372 CCAAAGCCTAATCCAGACCAAGG - Intronic
958899687 3:99871255-99871277 CCTAAACAAAATCTAGAAGAAGG + Intronic
958933111 3:100228863-100228885 CCAAAACCTAATCCAGTGCAAGG + Intergenic
958971985 3:100621513-100621535 CTAAAGCCTAATCCAGAACAAGG + Intronic
959281084 3:104341498-104341520 CCAAAACCGAATTCATAAGAAGG - Intergenic
959511213 3:107214595-107214617 CCAAAGCCTAATCCAGGATAAGG + Intergenic
959721664 3:109497642-109497664 CCAAAGCCTAATCCAGAGCAGGG - Intergenic
960669086 3:120139649-120139671 CCAAAACCTAATCCAGAACAAGG + Intergenic
960863234 3:122173783-122173805 CCAAAACCTAATCCAGAGCAAGG - Intergenic
961152735 3:124653201-124653223 CCAAGACTCAATCCAGAAGATGG + Intronic
962173889 3:133131973-133131995 CCAAAGCCTAATCCAGAGTAAGG + Intronic
963081345 3:141397334-141397356 CCGAAGCCTAATCCAGAGTGAGG - Intronic
963082032 3:141402862-141402884 CCGATTCCCAATCCAGGAGACGG - Intronic
963198658 3:142564007-142564029 CCAAAGCCTAATCCAGAGAAAGG + Intronic
963608770 3:147438918-147438940 CCCAAGCCTAATCCAGATTAAGG - Intronic
963916347 3:150862061-150862083 CCGAATCCCAAACCAGAAGCAGG - Intergenic
963952062 3:151213717-151213739 AAGAAACACAATCCAGAAGATGG + Exonic
964061473 3:152529793-152529815 CCAAAATCTAATCCAGAACAAGG - Intergenic
964076226 3:152695608-152695630 CCAAACTCTAATCCAGAACAAGG + Intergenic
964146592 3:153471351-153471373 CCAAACCCTAATCCAGAGCAAGG - Intergenic
964185944 3:153942743-153942765 CCAAAGCCTAATCCAGAGCAAGG - Intergenic
964813617 3:160692926-160692948 CCAAAGCCTAATCCAGAGCAAGG + Intergenic
964870427 3:161307910-161307932 CCAAAACCTAATTCAGAGCAAGG + Intergenic
965276386 3:166688243-166688265 CCAAAACTTAATCCAGAGCAAGG + Intergenic
965352292 3:167628520-167628542 CCAAAACCTAATACAGAGCAAGG + Intronic
965868003 3:173229243-173229265 CCAAAGCCTAATCCAGAGCAAGG - Intergenic
966070343 3:175869840-175869862 CCAAAGCCTAATCCAGAGCAAGG + Intergenic
966098181 3:176231443-176231465 TCAAAGCCTAATCCAGAACAAGG - Intergenic
966503393 3:180671727-180671749 CCAAAGCCTAATCCAGAGAAGGG + Intronic
966750834 3:183320591-183320613 CCAAAGCCTAATCCAGAGCAAGG - Intronic
968153683 3:196360017-196360039 CCAAAGCCTAATCCAAAACAAGG + Intronic
968438167 4:606281-606303 CCAAAGCCTAATCCAGAGCAAGG + Intergenic
971355289 4:25889865-25889887 CAACACCCTAATCCAGAAGAGGG + Intronic
971441301 4:26690144-26690166 CCAAAGCCTAATCCAGAGCAAGG + Intronic
971645645 4:29198027-29198049 CTGACACCAAATCCAGAAAAAGG - Intergenic
971868611 4:32206412-32206434 CCAAAGCCTAATCCAGAGTAAGG + Intergenic
971881282 4:32376989-32377011 CCAAAGCCTAATCCAGAGCAAGG - Intergenic
972383674 4:38542961-38542983 CCAAAGCCTAATCCAGAGCAAGG - Intergenic
972560349 4:40222020-40222042 CCAAAGACTAATCCAGAACAAGG + Intronic
972837370 4:42889379-42889401 CCAAAGCCTAATCCAGAGCAAGG + Intergenic
972894183 4:43598478-43598500 CTGTAACCTACTCCAGAAAATGG - Intergenic
973128199 4:46615284-46615306 CCAAAGCCTAATCCAGAGCAAGG + Intergenic
973697433 4:53504419-53504441 CCAAAGCCTAATCCAGAGGAAGG - Intronic
974397066 4:61351194-61351216 CCAAAGCCTAATCCAGGGGAAGG + Intronic
974859278 4:67499564-67499586 CCAAAGCCTAATCCAGAGGAAGG - Intronic
975077437 4:70229284-70229306 CAGAAGCCTAATCTAGAAGAAGG - Intronic
975995337 4:80307627-80307649 CCAAAACCTAATGCAGTAGCTGG + Intronic
977092066 4:92689918-92689940 CCAAAGCCTAATCCAGAGTAAGG - Intronic
977356022 4:95947857-95947879 CCAAAGCCTAATCCAGACCAAGG - Intergenic
977867982 4:102052458-102052480 ACTAAAACTACTCCAGAAGAAGG + Intronic
977915767 4:102590954-102590976 CCAAAGCCTAATCCAGAGAAAGG + Intronic
977981227 4:103324860-103324882 CCAAAGCCTAATCCAGAGCAAGG - Intergenic
978249386 4:106611791-106611813 CCAAAGCCTAATCCAGAGCAAGG - Intergenic
978286900 4:107089732-107089754 CCAAAGCCTAATCCAGAGCAAGG + Intronic
978530196 4:109704478-109704500 CCAAAGCCTAATCCAGAGCAAGG + Intergenic
979190092 4:117846180-117846202 CCAAAGCCTAATCCAAAACAAGG + Intergenic
979307758 4:119167314-119167336 CCAAAACCCAATCCAGAGCAAGG + Intronic
979729409 4:124006017-124006039 CCAAGACCTAATCCAGAGCAAGG - Intergenic
979933680 4:126665123-126665145 CCCAGGCCTAATCCAGAGGAAGG + Intergenic
980858405 4:138468963-138468985 CCAAAGCCTAATCCAGAGAAAGG + Intergenic
980952840 4:139398660-139398682 CCAAAGCCTAATCCAGAGCAAGG - Intronic
981200674 4:141975853-141975875 CCAAAACCTAATTCAGAGCAAGG + Intergenic
981391905 4:144200734-144200756 CCAAAGCCTAATCCAGAGCAAGG - Intergenic
981526583 4:145712506-145712528 CCAAAGCCTAATCCAGAGAAAGG + Intronic
982036351 4:151349762-151349784 CCAAAGCCTAATCCAGAGCAAGG + Intergenic
982169941 4:152651587-152651609 CCTAAGCCTAATCCAGAGCAAGG - Intronic
982300459 4:153873432-153873454 CCAAAGCCTAATCCAGAGCAAGG + Intergenic
982344609 4:154343669-154343691 CCAAAGCCTAATCCAGAGCAAGG - Intronic
982439076 4:155413682-155413704 CCAAAGCCTAATGCAGAACAAGG - Intergenic
982681727 4:158439150-158439172 CCAAAGCCTAATCCAGAGCAAGG + Intronic
982697080 4:158614613-158614635 CCAAAGCCTAATCCAGAGCAAGG - Intronic
982876065 4:160651479-160651501 GCAAAACCTAATTCAGAAAAAGG + Intergenic
982968142 4:161942236-161942258 ACAAAACCAAATCCAGTAGATGG + Intronic
983086662 4:163453560-163453582 CCGAAATCCAATCCAGAGCAAGG - Intergenic
983161507 4:164421406-164421428 CCAAAACTTAATCCAGAGCATGG + Intergenic
983300915 4:165924442-165924464 CCAAAGCCTAATCCAGAACAAGG + Intronic
983597110 4:169482178-169482200 CCAAAGCCTAATCCAGAGCAAGG - Intronic
983701971 4:170608052-170608074 CCAAAACCTAATCCAGAGTAAGG - Intergenic
984084321 4:175289721-175289743 CCAAAATCTAATCCAGAGCAAGG - Intergenic
984386276 4:179062683-179062705 CTGAGACCAAATTCAGAAGAAGG + Intergenic
984438995 4:179741705-179741727 CCAAAACCTAATCCACAGCAAGG + Intergenic
984545105 4:181092113-181092135 CTGAAGCCTAATCCAGAGCAAGG - Intergenic
984607601 4:181803655-181803677 CAGGCACCTACTCCAGAAGATGG + Intergenic
984822991 4:183899572-183899594 CCAAAGCCTAATCCAGAGCAAGG + Intronic
985088102 4:186335167-186335189 CCAAAGCCTAATCCAGAGAAAGG + Intergenic
985185564 4:187311495-187311517 CCGAAGCTTAATCCAGCACAGGG - Intergenic
985430284 4:189872631-189872653 CCAAATCCTAATTCAGAGGAAGG + Intergenic
986028483 5:3872899-3872921 CAGAAGCCCAATCCAGAAGAGGG + Intergenic
986408435 5:7450389-7450411 CCAAAGCCTAATCCAGAGAAAGG + Intronic
986631561 5:9778760-9778782 CCAAAGCCTAATCCAGAGCAAGG - Intergenic
987058668 5:14220706-14220728 ACAAAGCCTAATCCAGAACAAGG + Intronic
987715966 5:21571488-21571510 CCAAAGCCTAATCCAGAGCAAGG + Intergenic
988141686 5:27250739-27250761 CAGAAACCTCCTCCAGAAAATGG - Intergenic
988274479 5:29063201-29063223 CCAAAACCTAATCCACAGCAAGG + Intergenic
989190642 5:38666777-38666799 CCAAAAACTCATCCAAAAGATGG - Intergenic
989532740 5:42526279-42526301 CCAAAGCCTAATCCAGAGCAAGG + Intronic
989654074 5:43725529-43725551 GCCAAACCTAATCCAGAGCAAGG - Intergenic
989729324 5:44629441-44629463 CCAAAACCTAATCCAGAGCAAGG + Intergenic
989760125 5:45005344-45005366 CTGAAGCCTAATCCAGAGCAAGG + Intergenic
990068118 5:51743941-51743963 CCAAATCCTAATCCAGAACAAGG - Intergenic
990523148 5:56599115-56599137 CCAAAGCCTAATCCAGAGCAAGG - Intronic
990572049 5:57088741-57088763 ACCAAACCTAATCCAGAACAAGG + Intergenic
991936201 5:71803250-71803272 CCAAAACCTAATCCAGAGCAAGG - Intergenic
992074587 5:73179414-73179436 CCAAAGCCTAATCCAGAGCAAGG + Intergenic
992271305 5:75066173-75066195 CCAAAACCTAATCCAGAGCAAGG + Intergenic
992462809 5:76978007-76978029 CCAAAACCTAATCCAGAGCAAGG + Intronic
992575006 5:78098982-78099004 TTGAAACCTAATCCAGACTATGG + Intronic
992820821 5:80494173-80494195 CCAAAGCCTAATCCAGAGTAAGG + Intronic
993082165 5:83315198-83315220 CCGAAGCCTAATCCAGAGCAAGG + Intronic
993124286 5:83813606-83813628 CCAAAACCAAATTCAGAACAAGG - Intergenic
993126385 5:83841134-83841156 CCAAAGCCTAATCCAGAGCAAGG + Intergenic
993180884 5:84550296-84550318 CAGAAAACTAATACAGAAGTCGG + Intergenic
993349589 5:86832110-86832132 CCAAAGCCTAATCCAGAGCAAGG - Intergenic
993599782 5:89907450-89907472 CCAAAGCCTAATCCAGAGCAAGG - Intergenic
995291491 5:110461325-110461347 CCAAAGCCTAATCCAGAGCAAGG + Intronic
995426386 5:112028192-112028214 CCAAAACCTAATCCAGAGCAAGG + Intergenic
995802149 5:116008699-116008721 CCAAAGCCTAATCCAGAGCAAGG + Intronic
995886980 5:116906272-116906294 CCAAAACCTAATCCAGAGCAAGG + Intergenic
995989614 5:118221490-118221512 CCAAAGCCTAATCCAGAGCAAGG - Intergenic
996072866 5:119154481-119154503 CCAAAGCCTAATCCAGAACAAGG + Intronic
996209868 5:120794989-120795011 CCAAAATCTAATCCAGAGCAAGG + Intergenic
996351997 5:122554218-122554240 CCAAAGCCTAATCCAGAGCAAGG + Intergenic
997162953 5:131628379-131628401 CCAAAACCTAATCCACAGCAAGG + Intronic
997835484 5:137188982-137189004 CCAAAACCTAGTCCAGAGCAAGG + Intronic
998510056 5:142705630-142705652 CCAAAGCCTAATCCAGAGCAAGG + Intergenic
999551518 5:152692558-152692580 CCAAAGCCTAATCCAGAGAAAGG - Intergenic
1000080945 5:157846397-157846419 CCAAAGCCTAATCCAGAGCAAGG + Intronic
1000549878 5:162647768-162647790 TCAAAACCTAATCCAGAGCAAGG - Intergenic
1000758264 5:165187690-165187712 CAGAAGCCTAATCCAGAGTAAGG + Intergenic
1000821289 5:165987636-165987658 CCAAAGCCTAATCCAGAGAAAGG + Intergenic
1000838759 5:166189424-166189446 CCAAAGCCTAATTCAGAACAAGG + Intergenic
1001091375 5:168743880-168743902 CCAAAGCCTAATCCAGAGCAAGG + Intronic
1002619111 5:180474530-180474552 ATGTAAACTAATCCAGAAGAGGG + Intergenic
1002985101 6:2182149-2182171 CCAAAGCCTAATCCAGAGCAAGG + Intronic
1003008087 6:2400318-2400340 CCAAAGCCTAATCCAGAGCAAGG + Intergenic
1003231909 6:4261889-4261911 CAGAAACCTAACCCATAAGATGG + Intergenic
1003404007 6:5813659-5813681 CCAAAGCCTAATCCAGAGCAAGG - Intergenic
1003473209 6:6456661-6456683 CCAAAACCTAATCTAGAACAAGG + Intergenic
1003745327 6:8994742-8994764 CCAAATCCTTATCCAGAAAATGG + Intergenic
1003830908 6:10010402-10010424 CCAAAGCCTAATCCAGAGCAAGG - Intronic
1004067919 6:12267492-12267514 CCAAAATCTAATCCAGAGCAAGG + Intergenic
1004550369 6:16641043-16641065 CCAAAGCCTAATCCAGATCAAGG + Intronic
1004922781 6:20392500-20392522 CCAAAGCCTAATCCAGAGCAAGG - Intergenic
1004926648 6:20422315-20422337 CCAAAGCCTAATCCAGAGCAAGG - Intronic
1004978560 6:20996137-20996159 CACAAACCTAATCCAGAGCAAGG - Intronic
1005402211 6:25446520-25446542 CCAAAGCCTAATCCAGAACAAGG - Intronic
1005663889 6:28029484-28029506 CCAAAGCCTAATCCAGAGTAAGG + Intergenic
1006245841 6:32734814-32734836 GCAAAAACTAATCCAAAAGAAGG - Intergenic
1006693472 6:35910361-35910383 CCAAAACCCAATCCAGAGCAAGG + Intronic
1007331334 6:41111877-41111899 ACAAAACCTAACCCAGATGAAGG + Intergenic
1008125855 6:47667425-47667447 CCAAAGCCTAATCCAGAGCAAGG + Intronic
1008733153 6:54507834-54507856 CTAAAGCCTAATCCAGAATAAGG - Intergenic
1008883990 6:56411693-56411715 CCCAAACCTACTCAAGAACAAGG + Intergenic
1008916917 6:56797926-56797948 CCAAAGCCTAATCCAGAGCAAGG + Intronic
1009000753 6:57710572-57710594 CCAAAGCCTAATCCAGAGCAAGG - Intergenic
1009274626 6:61659817-61659839 CCCAACCTTAATCCAGACGAAGG - Intergenic
1009461149 6:63914813-63914835 CCAAAAGCTAATCCAGAGCAGGG + Intronic
1010047499 6:71463495-71463517 CAGAAAAATAATCCAGAAAAGGG + Intergenic
1010693101 6:78933736-78933758 CCAAAACCTAATCCAGAGAAGGG - Intronic
1010697360 6:78993122-78993144 CCAAAGCCTAATCCAGAGCAAGG + Intronic
1011908492 6:92404309-92404331 CCAAAACTCAATCCAGAGGAAGG - Intergenic
1012109036 6:95202884-95202906 CCAAAACCTAATCCAGAGGAAGG - Intergenic
1012727496 6:102833690-102833712 CCAAAACGTAATCCAGAGCAAGG + Intergenic
1012836694 6:104278556-104278578 CCCAAATCTAATCCAGAGAAAGG - Intergenic
1013146069 6:107394134-107394156 CTAAAAAATAATCCAGAAGAAGG - Intronic
1013172722 6:107651398-107651420 CCAAAACTTAATCCAGAGCAAGG + Intronic
1013261257 6:108445243-108445265 CCAAAGCCTAATCCAGAGAAAGG - Intronic
1013414729 6:109914490-109914512 CCAAAGCCTAATCCAGAGCAAGG + Intergenic
1013493557 6:110674919-110674941 ACAAAGCCTAATCCAGAACAAGG + Intronic
1013602078 6:111714447-111714469 CCGAAACGAAATTCACAAGAAGG + Intronic
1013820791 6:114151576-114151598 CAGAAAGCTAATCAACAAGATGG - Intronic
1014130415 6:117825177-117825199 CCAAAGCCTAATCCAGAGTAAGG - Intergenic
1014262471 6:119235433-119235455 CCAAAACCTACTCCAGAGTAAGG + Intronic
1014521552 6:122449498-122449520 CCAAAGCCTAATCCAGAGCAAGG + Intronic
1014615695 6:123596230-123596252 CCAAAGCCTAATCCAGACCAAGG + Intronic
1014618002 6:123627953-123627975 CCAAAGCCTAATCCAGACCAAGG - Intronic
1014928416 6:127303485-127303507 CCAAAGGCTAATCCAGAACAAGG + Intronic
1015009943 6:128333627-128333649 CCAAAGCCTAATCCAGAGCAAGG - Intronic
1015746491 6:136515242-136515264 CCAAAGCTTAATCCAGAACAAGG - Intronic
1016081636 6:139864388-139864410 CCAAAGCCTAATCCAGAACAAGG + Intergenic
1016344138 6:143093408-143093430 CCAAAACCTAATCCAGAGCAAGG - Intronic
1016564100 6:145433022-145433044 CTGACACCTAATCCAGATCAAGG - Intergenic
1016608944 6:145966027-145966049 CCAAAGCCTAATCCAGAGCAAGG + Intergenic
1016848037 6:148588420-148588442 CCAAAGCCTAATCCAGAACAGGG + Intergenic
1016903303 6:149123564-149123586 CCAAAGCCTTATCCAGAACAAGG + Intergenic
1017314403 6:153013764-153013786 CCAAACCCTAATCCAGAGCAAGG + Intronic
1017631419 6:156399619-156399641 CAGTTACCTAATCCAGTAGAAGG - Intergenic
1018250547 6:161865708-161865730 CCAAAACCTAATCCAGAGCAAGG - Intronic
1018271422 6:162082410-162082432 CAAAAACCTAATCCAGAGGAAGG - Intronic
1018337306 6:162807141-162807163 CCAAAGCCTAATCCAGAGGAAGG - Intronic
1018587295 6:165375392-165375414 CCAAAAGCTAATCCAGAGCAAGG + Intronic
1018818296 6:167352292-167352314 CCAAAGCCTAATCCAGAGCAAGG + Intronic
1019895769 7:3981699-3981721 CCAAAGCCTAACCCAGAACAAGG + Intronic
1020727685 7:11836256-11836278 CCAAAGCCTAATCCAGAGAAAGG + Intergenic
1020802055 7:12744046-12744068 CCAAAACCTATTCTGGAAGAAGG + Intergenic
1021221731 7:17982233-17982255 CCAAAGCCTAATCCAGAGCAAGG - Intergenic
1021376542 7:19914762-19914784 CCAAAGTCTAATCCAGAACAAGG - Intergenic
1021614009 7:22483948-22483970 CCAAAGCCTAATCCAGAGCAAGG + Intronic
1021829828 7:24594235-24594257 CCAAAGCCTAATCCAGAGTAAGG - Intronic
1022566694 7:31410590-31410612 CCAAAGCCTAATCCAGAGTAAGG + Intergenic
1022594591 7:31700341-31700363 CCAAAGCCTAATCCAGAACAAGG + Intronic
1023773205 7:43578885-43578907 CCAAAGCCTAATCCAGAGCAAGG - Intergenic
1024257992 7:47553036-47553058 CCAAAGCCTAATCCAGAGCAAGG + Intronic
1024837923 7:53545761-53545783 CCAAAAACTAATCCAGAGCAAGG + Intergenic
1024847565 7:53665615-53665637 TCAAAACCAAATCCAGCAGAGGG - Intergenic
1025073311 7:55920472-55920494 CCAAAGCCTAATCCAGAGCAAGG + Intronic
1025938463 7:66056299-66056321 CCAAAGCCTAATCCAGAGCAAGG + Intergenic
1025945985 7:66104914-66104936 CCAAAGCCTAATCCAGAGCAAGG - Intronic
1025968702 7:66301280-66301302 CCAAAGCCTAATCCAGAGCAAGG - Intronic
1026256090 7:68712981-68713003 CCAAAGCCTAATCCAGAGCAAGG - Intergenic
1026507760 7:71000432-71000454 CCAAAACCTAATCCACAAGAAGG + Intergenic
1026590368 7:71689486-71689508 CAAAAGCCTAATCCAGAACAAGG + Intronic
1027379239 7:77587970-77587992 CCAAAGCCTAATCCAGAGCAAGG - Intronic
1027526444 7:79275369-79275391 CCAAAGCCTAATCCAGAGCAAGG + Intronic
1027917616 7:84346207-84346229 CCAAATCCTAATCCAGAGCAAGG - Intronic
1028210044 7:88062467-88062489 CCAAAACCTAACCCAGAATAAGG - Intronic
1028349508 7:89827900-89827922 CCAAAGCCTAATCCAGAGCAAGG + Intergenic
1028578189 7:92376881-92376903 CCAAATCCTAATCCAGAGCAAGG - Intronic
1030038269 7:105426685-105426707 CCAAAACCTAATCCAGAGCAAGG - Intergenic
1030387343 7:108880455-108880477 CCAAAACCTAATCCTGAGCAAGG + Intergenic
1030426027 7:109379510-109379532 CCAAAGCCAAATCCAGAACAAGG + Intergenic
1030494951 7:110287396-110287418 CCAAAGCCTAATCCAGAGCAAGG - Intergenic
1030723148 7:112893492-112893514 CCAATACCTAATCCAGAGCAAGG - Intronic
1030906015 7:115183708-115183730 CCAAAGCCTAATCCAGAGAAAGG + Intergenic
1031051003 7:116945447-116945469 CGGAAACCTAATCCAAAAAAAGG - Intergenic
1031498766 7:122485468-122485490 CCAAAGCCTAATCCAGAGCAAGG + Intronic
1031588573 7:123562675-123562697 CCAAAACCTAATCCAGAGCAAGG - Intergenic
1031815251 7:126425776-126425798 CTGAAACCCGATCCAGAACAAGG - Intergenic
1031860188 7:126970515-126970537 CCAAAACCTAATCCAGAGCAAGG - Intronic
1031921511 7:127605141-127605163 CCAAAGCCTAATCCAGAGCAAGG - Intergenic
1032701681 7:134385876-134385898 CCAAAACCGAATCCAGAGCAAGG + Intergenic
1032712949 7:134477959-134477981 CCAAAGCCTAATCCCGAACAAGG - Intergenic
1032769006 7:135029528-135029550 CCAAAGCCTAATCCAGAGGAAGG - Intronic
1033080536 7:138292800-138292822 CCAAAGCCTAATCCCGAAGAAGG - Intergenic
1033152780 7:138930672-138930694 CCAAAGCCTAATCCAGAGCAAGG - Intronic
1036282573 8:7414471-7414493 AAGAAACCTTAGCCAGAAGAAGG + Intergenic
1036338899 8:7897078-7897100 AAGAAACCTTAGCCAGAAGAAGG - Intergenic
1036735669 8:11313278-11313300 CCAAAGCCTAATCCAGAGGAAGG - Intronic
1037218520 8:16487580-16487602 CCCAAGCCTAATCCAGAGCAAGG - Intronic
1037390501 8:18387185-18387207 CCAAAACCTAAGCAGGAAGAAGG - Intergenic
1037428641 8:18785468-18785490 CCAAAACCTAATCCAGAGCAAGG - Intronic
1038094105 8:24288068-24288090 CCAAAACCTATTCCAGTAGTTGG + Intergenic
1038424644 8:27456866-27456888 CCAAAGCCTAATCCAGAGCAAGG + Intronic
1038526987 8:28283232-28283254 CCAAAGCCTAATCCAGAGGAAGG + Intergenic
1039192334 8:34990857-34990879 CCAAAGCCTAATCCAGAGCAAGG + Intergenic
1039381997 8:37094237-37094259 CCAAAACCTAATCCAGAGCAAGG + Intergenic
1039652667 8:39359093-39359115 CCAAAGCCTAATCCAGAGCAAGG + Intergenic
1040068196 8:43166035-43166057 CCAAAGCCTAATCCAGAGCAAGG + Intronic
1040732372 8:50464104-50464126 CCAAAGCCTAATCCAGAGCAAGG - Intronic
1040754074 8:50749236-50749258 CCAAAGCCTAATCCAGGGGAAGG + Intronic
1041055440 8:53981033-53981055 CCAAAGCCTAATCCAGAAAAAGG + Intronic
1041626644 8:60036526-60036548 CCGAAGCCTAATCCAGAGCAAGG + Intergenic
1042140385 8:65672866-65672888 CCAAAGCCTAATCCAGAGCAAGG - Intronic
1042306450 8:67338283-67338305 CCCAAACCTCTTCTAGAAGATGG + Intronic
1042882376 8:73507980-73508002 CCAAAGCCTAATCCAGAGCAAGG - Intronic
1044030864 8:87235135-87235157 ATGAAACCTAATCCAGAACAAGG - Intronic
1044071178 8:87762050-87762072 CAGAGAGGTAATCCAGAAGATGG + Intergenic
1044114346 8:88316022-88316044 CCAAAGCCTAATCCAGAGCAAGG + Intronic
1044164272 8:88961801-88961823 CCAAAACCTAATCCAGAGCAAGG - Intergenic
1044639990 8:94369153-94369175 CCAAAGCCTAATCCAGAGCAAGG + Intergenic
1045381153 8:101627864-101627886 CCAAAGCCTAATCCAGAGCAAGG + Intronic
1045465532 8:102466186-102466208 CCAAAACCTAATCCAGATCAAGG - Intergenic
1045563505 8:103289594-103289616 CAAAAGCCTAATCCAGAACAAGG - Intergenic
1045907795 8:107369327-107369349 CCAAAACCTAGTCCAGAGCAAGG - Intronic
1046316762 8:112513028-112513050 CCAAAACCTAATCCAAAGGAAGG - Intronic
1046571720 8:115974568-115974590 CCAAAACCTAATCCAGAACCAGG - Intergenic
1047178159 8:122561543-122561565 CCAAAGCCTAATCCAGAGCAAGG - Intergenic
1047576851 8:126165859-126165881 CCAAAGCCTAATCCAGAGCAAGG - Intergenic
1047827953 8:128598240-128598262 CCAAAACCTAATCCAGAGCAAGG + Intergenic
1048079424 8:131109241-131109263 CCAAAACTTAATCCAGAAAAAGG - Intergenic
1048433421 8:134391856-134391878 CCAAAGCCTAATCCAGAGAAAGG + Intergenic
1049314221 8:141951643-141951665 CCAAAACCTAGTCCAGAGCAAGG + Intergenic
1050565084 9:6873622-6873644 CCAAATCCTAATCCAGAGCAAGG - Intronic
1050649803 9:7763770-7763792 ACAAAACCTAATCCAGAGCAAGG + Intergenic
1051123876 9:13781790-13781812 CCAAAGCCTAATCCAGAACAAGG + Intergenic
1051726380 9:20090871-20090893 CAGAAACATAATTCAGAATATGG + Intergenic
1051767749 9:20543068-20543090 CCAAAGCCTAATCCAGAGCAAGG - Intronic
1051770731 9:20576214-20576236 CCAAAGCCTAATCCAGAGCAAGG - Intronic
1051777765 9:20655096-20655118 CCAAAACCTAATCCAGAGCAAGG - Intergenic
1051852963 9:21530204-21530226 CCAAAGCCTAATCCAGAACAAGG - Intergenic
1051945028 9:22558076-22558098 CCCAAACCTAATCCAGAGTAGGG - Intergenic
1052442414 9:28514549-28514571 CCAAAACCTAATCTAGAGCAAGG + Intronic
1052543262 9:29838497-29838519 CCAAAGCCTAATCCAGAGCAAGG - Intergenic
1052706847 9:32004390-32004412 CAGAAACCTAATCCAAACTAAGG + Intergenic
1053113729 9:35483975-35483997 CCAAAACCTAATCCAGAGCAAGG - Intergenic
1053217726 9:36286476-36286498 CCAAAGCCTAATCCAGACCAAGG - Intronic
1053225168 9:36348621-36348643 CCAAAACCTAATCCAGAACAAGG + Intronic
1053578930 9:39382876-39382898 CCAAAGCCTAATCCAGAGGAAGG - Intergenic
1053843446 9:42210951-42210973 CCAAAGCCTAATCCAGAGGAAGG - Intergenic
1054100513 9:60941680-60941702 CCAAAGCCTAATCCAGAGGAAGG - Intergenic
1054121910 9:61217305-61217327 CCAAAGCCTAATCCAGAGGAAGG - Intergenic
1054585834 9:66965206-66965228 CCAAAGCCTAATCCAGAGGAAGG + Intergenic
1054839450 9:69720345-69720367 CCAAAACCTAATCCAGACTAAGG + Intronic
1055434704 9:76280950-76280972 CCAAAGCCTAATCCAGAGCAAGG + Intronic
1055547528 9:77394913-77394935 CCAAAGCCTAATCCAGAGCAAGG - Intronic
1056093755 9:83230365-83230387 CCAAAACCTGATCCAGAGCAAGG - Intergenic
1056140337 9:83672134-83672156 CCAAAGCCTAATCCAGAGCAAGG - Intronic
1056669162 9:88609107-88609129 ACTAAACCTAAGCAAGAAGAAGG - Intergenic
1056959587 9:91111201-91111223 CCAAAGCCTAATCCAGAGGAAGG - Intergenic
1057287336 9:93768516-93768538 CCAAAGCCTAATCCAGAGAAAGG - Intergenic
1057504532 9:95621944-95621966 CCAAAGCCTAATCCAGAGCAAGG + Intergenic
1058927994 9:109687581-109687603 CCAAAGCCTAATCCAGATCAAGG - Intronic
1059092967 9:111380906-111380928 CCAAAGCCTAATCCAGAGCAAGG - Intronic
1059917520 9:119119996-119120018 CCAAAGCCTAATCCAGAGCAAGG + Intergenic
1060677770 9:125531202-125531224 CCGTAACCTTATCCAGTAGAAGG + Intronic
1061784366 9:133017392-133017414 CCAAAACCTAATGCAGAGCAAGG + Intergenic
1186849194 X:13563493-13563515 CCAAAACCTAACCCAGAGCAAGG - Intergenic
1187311057 X:18143257-18143279 CCAAAGCCTAATCCAGAGTAAGG + Intergenic
1187662896 X:21570438-21570460 CCAAAGCCTAATCCAGAGCAAGG - Intronic
1187760156 X:22574312-22574334 CCAAAGCCTAATCCAGAGCAAGG + Intergenic
1187890430 X:23929467-23929489 CCAAAGCCTAATCCAGAGCAAGG + Intronic
1188238077 X:27753278-27753300 CCAAAACCTAATCCAGAGTCAGG + Intergenic
1188456117 X:30368267-30368289 TCAAAGCCTAATCCAGAACAAGG - Intergenic
1188591435 X:31841226-31841248 CCAAAGCCTAATCCAGAGCAAGG + Intronic
1188732674 X:33670581-33670603 CCAAAGCCTAATCCAGAGGAAGG + Intergenic
1188833600 X:34930884-34930906 CCAAAGCCTAGTCCAGAGGAAGG + Intergenic
1189014567 X:37083522-37083544 CCAAAGCCTAATCCAGAGCAAGG + Intergenic
1189060123 X:37744750-37744772 CCAAAGCCTAATCCAGAGCAAGG - Intronic
1189174593 X:38943034-38943056 CCAAAGCCTAATCCAGAGCAAGG + Intergenic
1190460782 X:50671654-50671676 CCAAACCCTAATTCAGAAAAAGG - Intronic
1190482197 X:50888813-50888835 CCAAAGCCTAATCCAGAACAAGG - Intergenic
1190814182 X:53914305-53914327 CCAAAGCCTAATCCAGAGCAAGG + Intergenic
1192028708 X:67485518-67485540 TCAAAACCTAATCCAGAGAAAGG - Intergenic
1192074096 X:67973006-67973028 CAGATACCTAATGCAGATGATGG + Intergenic
1192084573 X:68083448-68083470 CCAAAGCCTAATCCACAGGAAGG - Intronic
1192301890 X:69913503-69913525 CCAAAGCCTAATCCAGAGCAAGG - Intronic
1193396090 X:80985284-80985306 CCAAATCCTAATCCAGAGCAAGG - Intergenic
1193470570 X:81897290-81897312 CCAAAACCTAATCCAGAGCAAGG - Intergenic
1193835693 X:86340862-86340884 CCAAAGCCTAATCCAGAGCAAGG + Intronic
1193906047 X:87245358-87245380 CCTAACCCTAATCCAGAGCATGG + Intergenic
1194062908 X:89226439-89226461 CCAAAGCCTAATTCAGAAGAAGG - Intergenic
1194260882 X:91694115-91694137 CTGAAACCTAATCCACAACAAGG - Intergenic
1194588661 X:95769728-95769750 CCAAAGCCTAATCCAGAGCAAGG + Intergenic
1195676636 X:107511847-107511869 CAGAATGCTAAGCCAGAAGAGGG - Intergenic
1195690881 X:107624027-107624049 CCAAAGCCTAATCCAGAGCAAGG - Intergenic
1195792592 X:108604966-108604988 CAAAAACCTAATCCAGAGCAAGG - Intronic
1197557291 X:127971421-127971443 CCAAAGCCTAATCCAGAGTAAGG - Intergenic
1198180237 X:134200926-134200948 ATGAAACATAATCCAAAAGAAGG - Intergenic
1198281374 X:135146140-135146162 CCAAAGCCTAATCCAGAACAAGG - Intergenic
1198289585 X:135226376-135226398 CCAAAGCCTAATCCAGAACAAGG + Intergenic
1198304859 X:135370270-135370292 CCAAAGCCTAATCCAGAGCAAGG + Intergenic
1198323110 X:135539428-135539450 CCAAAGCCTAATCCAGAGCAAGG - Intronic
1198826568 X:140704551-140704573 CCAAATCCTAATCCAGAGCAAGG - Intergenic
1200579534 Y:4932917-4932939 CTGAAACCTAATCCACAACAAGG - Intergenic
1200716720 Y:6555107-6555129 CCAAAGCCTAATTCAGAAAAAGG - Intergenic
1201379069 Y:13352857-13352879 CCAAAGCCTAATCCAGAAAAAGG + Intronic
1202594169 Y:26519884-26519906 CCAAAGCCTAATCCAGGACAAGG + Intergenic