ID: 1122500397

View in Genome Browser
Species Human (GRCh38)
Location 14:102194285-102194307
Sequence AGAGGGATTTTGACCCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 6, 3: 45, 4: 280}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122500389_1122500397 -4 Left 1122500389 14:102194266-102194288 CCCCGAAACCTAATCCAGAAGAG 0: 1
1: 0
2: 0
3: 13
4: 85
Right 1122500397 14:102194285-102194307 AGAGGGATTTTGACCCAGGAAGG 0: 1
1: 0
2: 6
3: 45
4: 280
1122500388_1122500397 13 Left 1122500388 14:102194249-102194271 CCTCGATAAGTAATGTTCCCCGA 0: 1
1: 0
2: 0
3: 2
4: 67
Right 1122500397 14:102194285-102194307 AGAGGGATTTTGACCCAGGAAGG 0: 1
1: 0
2: 6
3: 45
4: 280
1122500390_1122500397 -5 Left 1122500390 14:102194267-102194289 CCCGAAACCTAATCCAGAAGAGG 0: 1
1: 0
2: 1
3: 29
4: 202
Right 1122500397 14:102194285-102194307 AGAGGGATTTTGACCCAGGAAGG 0: 1
1: 0
2: 6
3: 45
4: 280
1122500387_1122500397 26 Left 1122500387 14:102194236-102194258 CCTTTGATTATGGCCTCGATAAG 0: 1
1: 0
2: 0
3: 1
4: 52
Right 1122500397 14:102194285-102194307 AGAGGGATTTTGACCCAGGAAGG 0: 1
1: 0
2: 6
3: 45
4: 280
1122500392_1122500397 -6 Left 1122500392 14:102194268-102194290 CCGAAACCTAATCCAGAAGAGGG 0: 1
1: 0
2: 9
3: 139
4: 703
Right 1122500397 14:102194285-102194307 AGAGGGATTTTGACCCAGGAAGG 0: 1
1: 0
2: 6
3: 45
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122500397 Original CRISPR AGAGGGATTTTGACCCAGGA AGG Intronic
902933333 1:19746406-19746428 AGAGGAATTTTCAGCCAGGGTGG - Intronic
904323072 1:29709226-29709248 AGAGGGATGCTTTCCCAGGAAGG + Intergenic
904364843 1:30003733-30003755 AAAGGAATTTTGCCCCAGAATGG + Intergenic
910218666 1:84867147-84867169 CGAGGGATCTTGGCCAAGGAAGG + Intronic
913012058 1:114693093-114693115 AGATGGATGGTCACCCAGGATGG - Intronic
913373319 1:118124905-118124927 AGAGGGACCGTGACCCAAGATGG - Intronic
915292906 1:154898213-154898235 AGAGGGGTCTTGACACAGGTGGG - Intergenic
916226489 1:162494662-162494684 AGATGGAATTTCACCCAGGCTGG - Intergenic
916483650 1:165237412-165237434 AGACGGGGTTTCACCCAGGATGG + Intronic
916732576 1:167579860-167579882 AGAATGACTTTAACCCAGGAGGG + Intergenic
917692245 1:177481659-177481681 AGAGGGATTTGGACACAGTAAGG - Intergenic
919741496 1:200983875-200983897 AGTAGTATTTTGACCCAGGAAGG + Intronic
921900092 1:220440991-220441013 AGAGGAATTCAGGCCCAGGAGGG + Intergenic
922527197 1:226313390-226313412 AGAGGGATTCTCATCAAGGAAGG - Intergenic
922982842 1:229842653-229842675 AGTGTGATTTGAACCCAGGAAGG - Intergenic
924023692 1:239811124-239811146 ATTGGGATTTTGAGTCAGGACGG - Intronic
924396909 1:243630347-243630369 AGAGGAATTTTGCCCCAGGGTGG - Intronic
924506162 1:244686407-244686429 ACAATTATTTTGACCCAGGAAGG + Intronic
924526282 1:244853345-244853367 AAAGGGATTTTGAACCTTGATGG + Intronic
924812708 1:247417242-247417264 CGAGGGGTTTAGAACCAGGAAGG - Intronic
1063910199 10:10821495-10821517 AGAAGGACTTTAACCCTGGAGGG - Intergenic
1064158040 10:12919889-12919911 AGAGGGAGTTTGACCAGGGATGG + Intronic
1066560832 10:36668227-36668249 AGGAAGGTTTTGACCCAGGAAGG - Intergenic
1066569087 10:36752065-36752087 AGAGGGAGTCTCACCCAGGCTGG - Intergenic
1066665889 10:37782265-37782287 AGAGGAATTTTACCCCAGGATGG + Intronic
1067035753 10:42915269-42915291 AGAAGAATTGTGCCCCAGGATGG - Intergenic
1068915677 10:62428740-62428762 AGTGGGATTTTTACTCAGTATGG - Intronic
1069011685 10:63381213-63381235 ACATGGATCTTGACCCAGCATGG + Intronic
1069253736 10:66305493-66305515 AAGGGGATTTTGAATCAGGATGG - Intronic
1069335653 10:67346954-67346976 AGAGTGATTCTGACTCAGGGAGG - Intronic
1070531479 10:77341306-77341328 AGAAGGACTTAGACCCAGAAAGG - Intronic
1073248143 10:102106092-102106114 AGAGGGGACTTGGCCCAGGAGGG - Intergenic
1075186326 10:120261835-120261857 TGAGTGTTTTTGAGCCAGGAAGG + Intergenic
1076990634 11:271543-271565 AGAGGGAATTGGATACAGGATGG + Intergenic
1077693923 11:4376179-4376201 AGCTGGAATTTGACCCAGGTAGG + Intergenic
1078038383 11:7833196-7833218 AGAGAAATTTTGCCCCAGGATGG + Intergenic
1078068912 11:8095744-8095766 GGAGGGGTTTGGACACAGGAAGG - Intronic
1078080336 11:8199815-8199837 AAGGGGAGATTGACCCAGGATGG - Intergenic
1078953117 11:16157841-16157863 AGAAGGAATGTGAACCAGGATGG - Intronic
1082072989 11:47954166-47954188 TCAGTGATTTTAACCCAGGAAGG - Intergenic
1082899799 11:58235020-58235042 AGATAGTTTTTGACCCAGAAAGG + Intergenic
1083421644 11:62556583-62556605 AGAGGGTTGTGGCCCCAGGAAGG - Intergenic
1085745252 11:79109535-79109557 AGAGGGTTTTGGAGCCAGGCAGG + Intronic
1087422217 11:97943900-97943922 AGAAGTATTTTGACCTAGGGTGG + Intergenic
1088094850 11:106086729-106086751 AGAGGAATTTTGCCCCAAGAAGG - Intronic
1088459177 11:110064596-110064618 AGAGAGGTTTTCACCCAGGCTGG - Intergenic
1088876187 11:113938438-113938460 AGAGAAATTTTGCCCCAGAATGG - Intronic
1090930616 11:131295174-131295196 ACAGGGGTTTTAACCCTGGATGG + Intergenic
1091152635 11:133343022-133343044 AGATGGAGTTTCACCCAGGCTGG + Intronic
1092728589 12:11507921-11507943 GGAGGGATTTAGACTCAGCAAGG - Intergenic
1093539792 12:20268008-20268030 AGACAGATACTGACCCAGGAAGG - Intergenic
1094229695 12:28088777-28088799 AGAGGGATTTTCACTGAGTAAGG - Intergenic
1094603267 12:31929247-31929269 AGAGTGATTTTTACCAAAGATGG - Intergenic
1095736700 12:45564994-45565016 ACAGGGTCTTTCACCCAGGATGG - Intergenic
1095952391 12:47788762-47788784 AGATGGATTTGAACCCAGGCGGG - Intronic
1096217208 12:49804351-49804373 AGAGGGACTGAGACCCAGGGAGG - Intronic
1097405632 12:59185798-59185820 AGAGGAATTGTAACCTAGGAAGG + Intergenic
1097751965 12:63365520-63365542 AGAGGAATTTTGCCCCAGGATGG - Intergenic
1098634830 12:72769742-72769764 AGAGGAATTTTGCCCCATGATGG - Intergenic
1099096136 12:78377821-78377843 AGGGTGATTTTGCCCCAGAAGGG + Intergenic
1100302125 12:93317320-93317342 AGATGGATTATGACCCACGGCGG - Intergenic
1100345180 12:93723174-93723196 AGAGGGGGTTTGTCTCAGGAAGG - Intronic
1102151929 12:110694550-110694572 ACAGGGCTTTTGCCCTAGGAAGG - Intronic
1102515563 12:113444079-113444101 AGATGGAGTTTTACCCAGGGTGG + Intergenic
1103933811 12:124464828-124464850 AATGGGATTTGAACCCAGGATGG + Intronic
1105201116 13:18179725-18179747 AGAGGGATTTTGAGGCAGGAAGG + Intergenic
1106593581 13:31118390-31118412 ATAGGGATTGTGACCCAAGAAGG - Intergenic
1107167005 13:37294205-37294227 ACAGTGATGTGGACCCAGGAAGG + Intergenic
1108224572 13:48275078-48275100 ACAGGGAGTTTGGCCAAGGATGG + Intergenic
1109690561 13:65882477-65882499 AGAAGGATTCTCACACAGGAAGG - Intergenic
1110725144 13:78814292-78814314 AGAGGGATTTGAATCCAGGCTGG - Intergenic
1112155183 13:96809514-96809536 AGAGGGATTCTGATTCAGCAAGG + Intronic
1112173227 13:96994613-96994635 GGAGGGTTGTTGCCCCAGGAGGG + Intronic
1112557462 13:100481681-100481703 AGAGGGTTTATGACCCAGGCAGG + Intronic
1112774967 13:102833696-102833718 AGAGGGATTCTGAGACAGGTTGG + Intronic
1113408449 13:110063105-110063127 AGAGGGCTTGTGAGCCGGGAGGG - Intergenic
1117862842 14:60110657-60110679 AGAGGAATTTTGCCTCAGGATGG + Intronic
1120658810 14:87228736-87228758 AAATGGATTTTTCCCCAGGAGGG - Intergenic
1122124066 14:99569770-99569792 GGAGGGATCTAGACCCAGGCAGG + Intronic
1122124117 14:99570083-99570105 AGGGGGATTTGGTCTCAGGAGGG - Intronic
1122143065 14:99673920-99673942 AGAGGGAGGTTCACTCAGGAGGG + Intronic
1122268214 14:100556586-100556608 AGAGGGCTCCTGACCCAGGGGGG - Intronic
1122327777 14:100892753-100892775 AGACGGAATGTGACCCAGAAAGG + Intergenic
1122500397 14:102194285-102194307 AGAGGGATTTTGACCCAGGAAGG + Intronic
1122606465 14:102950022-102950044 AGAGGGATGTTTGCCCAAGAAGG + Intronic
1123215107 14:106801888-106801910 AAAAAGATTATGACCCAGGATGG + Intergenic
1124187975 15:27546584-27546606 AGATGGGGTTTCACCCAGGATGG - Intergenic
1124206849 15:27728163-27728185 AGGGGAATTTTGCTCCAGGATGG - Intergenic
1124595918 15:31091485-31091507 TGAGGGATGGAGACCCAGGATGG + Intronic
1125020768 15:34984626-34984648 AGATGGATTCTCACCCAGGCTGG - Intronic
1126453889 15:48840539-48840561 AGAGGATTTTTGAGGCAGGAAGG + Intronic
1128717243 15:69917652-69917674 AGAGGGTTTTAGACTCAGGGTGG + Intergenic
1128751606 15:70154195-70154217 AGAGCTATTTTGAGCAAGGAGGG - Intergenic
1128972745 15:72121970-72121992 AGATGGAGTTTGACTGAGGAAGG - Intronic
1129074686 15:72983394-72983416 AGAGGAATTTTACCCCAGTATGG - Intergenic
1129463393 15:75711054-75711076 AGAGGGGTGTTGAGACAGGAAGG - Intronic
1129721494 15:77880348-77880370 AGAGGGGTGTTGAGACAGGAAGG + Intergenic
1130019205 15:80213144-80213166 AGAGGAATTTTGTCCCAGGGTGG + Intergenic
1131734065 15:95313515-95313537 AGAAGGATTTTGACCTGGAAAGG - Intergenic
1133403555 16:5505913-5505935 AGAGAGATTTTGAGCAGGGATGG - Intergenic
1133719026 16:8477037-8477059 AGAGGGCTTTTGAGCTGGGAGGG + Intergenic
1133918828 16:10133714-10133736 AGAGAAACTTTGACCCAGGAGGG - Intronic
1134509506 16:14834745-14834767 GGTGGGATTATGACCCAGAAAGG + Intronic
1134697211 16:16233561-16233583 GGTGGGATTATGACCCAGAAAGG + Intronic
1134974635 16:18561113-18561135 GGTGGGATTATGACCCAGAAAGG - Intronic
1135071189 16:19353213-19353235 AGAGAGATTTTTGCCCAGGCTGG - Intergenic
1135353739 16:21752196-21752218 AGTGGGATTTTAGCCCAGAAAGG - Intronic
1135452228 16:22568324-22568346 AGTGGGATTTTAGCCCAGAAAGG - Intergenic
1136243679 16:28960519-28960541 AGAGGAATTTTGTCCCAGAATGG - Intronic
1136863994 16:33726627-33726649 AGACGGATTATGAGGCAGGAAGG - Intergenic
1138033308 16:53578424-53578446 AGAGGCATTCTGGACCAGGAAGG + Intergenic
1138503645 16:57464799-57464821 AGAGGCATTTAGACTCAGAATGG - Intronic
1138604155 16:58077053-58077075 AGAGGAATTTTGCCTTAGGATGG + Intergenic
1138731536 16:59200687-59200709 AGAGGGACACTGACCCAAGAGGG - Intergenic
1140811921 16:78586756-78586778 AGAGGAATTTTGATTCAGGAAGG + Intronic
1140957614 16:79880202-79880224 AGACTGATTTTGAACCAGAATGG + Intergenic
1141861900 16:86722837-86722859 AGAAGGAGTTTAATCCAGGAAGG - Intergenic
1203125481 16_KI270728v1_random:1574765-1574787 AGACGGATTATGAGGCAGGAAGG - Intergenic
1143375171 17:6462984-6463006 AGGGGGACTGTGACGCAGGAGGG + Intronic
1146278770 17:31531689-31531711 GGAGGGATTGTGGTCCAGGATGG - Exonic
1146485024 17:33235735-33235757 AGATGAATTTTGCCCCAGGATGG + Intronic
1147266356 17:39237130-39237152 AGAGGGAGGTTTGCCCAGGAGGG - Intergenic
1150801640 17:68287791-68287813 ACAGGCATTATCACCCAGGAAGG - Intronic
1151508490 17:74544177-74544199 AGAGCGAGTTAGACCCAGGCGGG + Intronic
1152417236 17:80170632-80170654 AGAAGGATGTTGACCTGGGAGGG + Intronic
1154312473 18:13277887-13277909 AGGGGGATTTTGTCCCAGTTTGG + Intronic
1155520861 18:26667719-26667741 ACAGGGATTATGACCCAGCAGGG - Intergenic
1156127250 18:33921172-33921194 AGTGAAATTTTGCCCCAGGATGG + Intronic
1156132419 18:33992633-33992655 AGAGGGCTATCTACCCAGGAGGG + Intronic
1156520584 18:37719554-37719576 AGAGGAATTTGGACCAAGTAGGG + Intergenic
1156745687 18:40388616-40388638 AGAGGAATTTTAACCCTGGTTGG + Intergenic
1157330846 18:46702709-46702731 ACAGGGAACTTGACCCAGGCTGG - Intronic
1158135563 18:54204045-54204067 GAAGGGCTTTGGACCCAGGAAGG - Intronic
1161758044 19:6149075-6149097 AGATGGAGTTTCACCCAGGCTGG - Intronic
1163055248 19:14713128-14713150 AGAGGAATTTTGCCCCACAATGG - Intronic
1163460952 19:17437172-17437194 GGTGGGATTTTAACCCAGGCTGG + Intronic
1163544656 19:17933756-17933778 AGAGGGCTTCTGACCCAGCCTGG - Intronic
1165236131 19:34423210-34423232 AGACGGAGTTTCACCCAGGTTGG + Intronic
1165718456 19:38062336-38062358 AGAGGGACTTGAACCCAGGCAGG - Intronic
1166850708 19:45759271-45759293 AGCGGGATTTGGACCTAGGGTGG + Intronic
1166975227 19:46601743-46601765 AAAGGATTTTGGACCCAGGATGG + Intronic
1167641547 19:50685315-50685337 GGGGGGATTTTAACCCAGGCAGG - Intronic
1167916288 19:52742747-52742769 TGTGGGTTTTTGCCCCAGGAAGG - Intergenic
1167965512 19:53142346-53142368 GGAGTGCTTTTGACCCAAGAAGG - Exonic
1168452209 19:56475466-56475488 AGAGTGATTTTGCCCCTGCAGGG + Intronic
926304637 2:11629056-11629078 AAAGGGATTTTGACTCGGGGAGG - Intronic
927360017 2:22222241-22222263 AGAGGGATTTTGTCCCAAGATGG + Intergenic
928405376 2:31010640-31010662 GGAGGGATTCTGAGCCAGAATGG - Intronic
929288470 2:40163196-40163218 AAAGGGCTTTGGACCCAAGAAGG + Intronic
929961962 2:46503728-46503750 AGAGTTATTTTGAGCAAGGAAGG + Intronic
931751812 2:65337496-65337518 AGAGGGATGTTGACGGTGGAGGG - Intronic
932102751 2:68915529-68915551 AGAGTGATTATAACACAGGAAGG + Intergenic
932572680 2:72946146-72946168 AGAGGGAGGATGACCCAGGAGGG - Intronic
934115213 2:88783384-88783406 AGAGGGATTGTGAGGCAGGAAGG + Intergenic
934628366 2:95885570-95885592 AGAGGGATTGTGAGGCAGGAAGG - Intronic
934628493 2:95887446-95887468 AGAGGGATTGTGAGGCAGGAAGG - Intronic
934628618 2:95889321-95889343 ATAGGGATTGTGAGTCAGGAAGG - Intronic
934628745 2:95891191-95891213 AGACGGATTGTGAGGCAGGAAGG - Intronic
934629010 2:95894926-95894948 AGACGGATTGTGAGGCAGGAAGG - Intronic
934629147 2:95896796-95896818 AGATGGATTGTGAGGCAGGAAGG - Intronic
934629424 2:95900542-95900564 AGACGGATTGTGAGGCAGGAAGG - Intronic
934629563 2:95902412-95902434 AGACGGATTGTGAGGCAGGAAGG - Intronic
934629839 2:95906158-95906180 AGACGGATTGTGAGGCAGGAAGG - Intronic
934630242 2:95911771-95911793 AGACGGATTGTGAGGCAGGAAGG - Intronic
934630381 2:95913638-95913660 AGACGGATTGTGAGGCAGGAAGG - Intronic
934630516 2:95915507-95915529 AGATGGATTGTGAGGCAGGAAGG - Intronic
934631437 2:95928591-95928613 GGAGGGATTGTGAGGCAGGAAGG - Intronic
934802594 2:97180392-97180414 AGAGGGATTGTGAGGCAGGAAGG + Intronic
934803384 2:97191634-97191656 AGACGGATTGTGAGGCAGGAAGG + Intronic
934803528 2:97193504-97193526 AGACGGATTGTGAGGCAGGAAGG + Intronic
934803814 2:97197239-97197261 AGACGGATTGTGAGGCAGGAAGG + Intronic
934803954 2:97199109-97199131 AGATGGATTGTGAGACAGGAAGG + Intronic
934804090 2:97200976-97200998 AGACGGATTGTGAGGCAGGAAGG + Intronic
934804230 2:97202844-97202866 AGACGGATTGTGAGGCAGGAAGG + Intronic
934804374 2:97204714-97204736 AGACGGATTGTGAGGCAGGAAGG + Intronic
934804509 2:97206586-97206608 AGACGGATTGTGAGGCAGGAAGG + Intronic
934804646 2:97208457-97208479 AGACGGATTGTGAGGCAGGAAGG + Intronic
934804780 2:97210323-97210345 AGACGGATTGTGAGGCAGGAAGG + Intronic
934804914 2:97212197-97212219 ATAGGGATTGTGAGTCAGGAAGG + Intronic
934805034 2:97214071-97214093 AGAGGGATTGTGAGGCAGGAAGG + Intronic
934805158 2:97215953-97215975 AGAGGGATTGTGAGGCAGGAAGG + Intronic
934832325 2:97541433-97541455 AGAGGGATTGTGAGGCAGGAAGG - Intronic
934832449 2:97543309-97543331 AGAGGGATTGTGAGGCAGGAAGG - Intronic
934832567 2:97545188-97545210 ATAGGGATTGTGAGTCAGGAAGG - Intronic
934832692 2:97547063-97547085 AGATGGATTGTGAGGCAGGAAGG - Intronic
934832827 2:97548934-97548956 AGACGGATTGTGAGGCAGGAAGG - Intronic
934833602 2:97560184-97560206 AGAGGGATTGTGAGGCAGGAAGG - Intronic
935793039 2:106611649-106611671 AGAGGGCTTTCTTCCCAGGAGGG - Intergenic
935933754 2:108158590-108158612 AGAGAAATTTTGCCCCAAGATGG + Intergenic
936521811 2:113216280-113216302 AGATGGATTTTCTTCCAGGAGGG + Exonic
936617711 2:114065425-114065447 AGAGAGTTTTTGATCCAGAATGG + Intergenic
938186125 2:129233495-129233517 CTAGGGATTTTGAAGCAGGAGGG - Intergenic
938726330 2:134111784-134111806 AGAGGAATTTTTCCCCAAGATGG + Intergenic
939340529 2:140889750-140889772 AGAAGCAATTTGACCCATGATGG + Intronic
942124439 2:172809345-172809367 AGAGGAACTGGGACCCAGGAAGG + Intronic
945378698 2:209112531-209112553 AGAGGCCTTTTGTACCAGGAGGG + Intergenic
945579156 2:211570956-211570978 AGAAGGATTTTGAAGAAGGATGG - Intronic
948292157 2:236833622-236833644 AAAAGGAATTTGACCAAGGATGG + Intergenic
948758233 2:240171915-240171937 AGGGGCATTTTTAGCCAGGAAGG + Intergenic
948943669 2:241208808-241208830 AGAGGAATTTTGCCTCAGGACGG - Intronic
1168861797 20:1050948-1050970 GGTGGGATTTGAACCCAGGAAGG - Intergenic
1171209779 20:23308409-23308431 AGAGGGCTATTGCCACAGGAAGG - Intergenic
1171237144 20:23536166-23536188 AGCGGGACGTTGACCCTGGATGG + Intergenic
1173479584 20:43388664-43388686 AGAGGCATTCTGCCCAAGGAGGG + Intergenic
1175477492 20:59287211-59287233 AGAGGAATTTTGTCTGAGGATGG + Intergenic
1176974320 21:15301677-15301699 AGCGGGAATTTGAACCAGGCAGG + Intergenic
1178869607 21:36361855-36361877 AGAGGGAGTCTTGCCCAGGATGG - Intronic
1179402621 21:41098025-41098047 AAAGGAATTTTGCCCCTGGATGG - Intergenic
1182749327 22:32628945-32628967 GGAGGGACTTAGACCCAGGAGGG + Intronic
1182935973 22:34221904-34221926 AGAATGTTTTTGATCCAGGAGGG + Intergenic
1183104731 22:35607693-35607715 AGGGACATTTGGACCCAGGAGGG + Intronic
1183670750 22:39270953-39270975 AGGGGGATTCTCACCCAGGCAGG - Intergenic
1184864848 22:47196368-47196390 AGAGGGATATGGAACCAGCAAGG - Intergenic
1185101230 22:48841936-48841958 AGAGGGATTCAGTCCCAGGTGGG + Intronic
1185103208 22:48852736-48852758 AGAGGGATTCTGCCCCAGGCAGG - Intergenic
1185241090 22:49748011-49748033 AGGTTGATTCTGACCCAGGAGGG + Intergenic
1185344224 22:50304393-50304415 AGAAGGCTTCTGAGCCAGGAGGG + Intronic
951462997 3:22970930-22970952 AGAGGGAATTTGAGCCAAAAGGG + Intergenic
951820113 3:26798718-26798740 AGAGAAATTTTGTGCCAGGATGG + Intergenic
956988304 3:74730704-74730726 ATAGAGATGTTGACCCAGGCTGG + Intergenic
961291424 3:125849735-125849757 AGAGGGATTCTGACCTAAAAAGG + Intergenic
962622789 3:137196439-137196461 AGAGAAATTTTGATCCAGGGTGG - Intergenic
964897436 3:161614588-161614610 AGATCTATTTTGACCTAGGAGGG - Intergenic
965081995 3:164045574-164045596 AGAGAAACTTTGACCCAAGATGG - Intergenic
967644172 3:191900918-191900940 GGAGAGCTTTTGAGCCAGGATGG + Intergenic
968642633 4:1722024-1722046 AGATGGAGTTGGCCCCAGGACGG - Intronic
970586916 4:17523154-17523176 AGAAGGTCTTAGACCCAGGAAGG - Intronic
970593701 4:17580546-17580568 AAAGTGAATTTGAGCCAGGAGGG - Intronic
970848673 4:20575006-20575028 AGAAGCCATTTGACCCAGGAAGG - Intronic
971398599 4:26254108-26254130 AGAATGATGTGGACCCAGGATGG - Intronic
975071066 4:70138950-70138972 AGAGGGAATTTCACGTAGGAGGG + Intronic
977046665 4:92076700-92076722 GGAGGGAGGTGGACCCAGGAAGG + Intergenic
978579300 4:110216526-110216548 AGTGGGCATTTGACCCAGGTGGG + Intergenic
979232193 4:118358506-118358528 ACAGGGATTTGAACCCAGGTGGG - Intergenic
980420328 4:132550922-132550944 AGATGGTTCTTGACACAGGATGG - Intergenic
982504284 4:156197969-156197991 AGAGGCATAATGACCCAGGGGGG - Intergenic
983499538 4:168483335-168483357 AGAGAAATTTTGCCTCAGGATGG + Intronic
983893563 4:173057336-173057358 AGAAGGATATTGGTCCAGGAAGG + Intergenic
983961642 4:173761909-173761931 AGAGGGATTTTGAGGAAAGAGGG + Intergenic
985651808 5:1111176-1111198 ACTGGGATTTGGAGCCAGGATGG + Intronic
988321504 5:29703881-29703903 AAAGCAATTTTGCCCCAGGATGG - Intergenic
991054728 5:62307645-62307667 AGACGGATTTTCACCCAGGCTGG + Intronic
991606334 5:68405238-68405260 AGAAGGCTTATGACCCAGGAAGG + Intergenic
992968745 5:82032863-82032885 TGAGGGATTTTGAGAAAGGAAGG + Intronic
993281242 5:85927343-85927365 ACAGCGACTTTGATCCAGGATGG - Intergenic
996502193 5:124229914-124229936 AGTGGGATCTTGACCCCGGCTGG - Intergenic
997951200 5:138243925-138243947 AGAGACATTTTGACTCAGGCTGG - Intergenic
998918726 5:147043903-147043925 GGTGGGATTTGGACCCAGGTAGG - Intronic
999074824 5:148784453-148784475 AAAGGAATTTTGCCCCAGAATGG - Intergenic
999271573 5:150299512-150299534 AGAGGGTTTTAGAGCCAGAAGGG + Intronic
1001815410 5:174664684-174664706 AGAGGAATTTTGCCTCAGGATGG - Intergenic
1001910293 5:175511574-175511596 AGAGGGATTTAGAGCCAGGCAGG - Intronic
1002052911 5:176581677-176581699 AGCGGGATTGTAACCCAGGCAGG - Intronic
1002058609 5:176612844-176612866 AGTGGGAAGGTGACCCAGGAAGG + Intergenic
1003277690 6:4666402-4666424 AGTGGGTATGTGACCCAGGATGG - Intergenic
1003631886 6:7794796-7794818 ACAGGGATTTGGACACAGGTTGG + Intronic
1004282683 6:14294334-14294356 AGAGGAATTATGACTCAGGTTGG - Intergenic
1004310253 6:14539268-14539290 GGATGGATTTTGACCAAGAAAGG + Intergenic
1004428556 6:15523164-15523186 TGAGGGATTTGGAACCTGGAGGG + Exonic
1006070205 6:31492973-31492995 AGCGGCATTTTCACCCAGGCTGG + Intergenic
1006173202 6:32107274-32107296 AGAGGGTCTTTGCACCAGGAAGG + Intronic
1006447847 6:34089991-34090013 GAAGGGATTTGAACCCAGGATGG - Intronic
1007054925 6:38873578-38873600 AGAGGGATGTTGTCAGAGGAAGG + Intronic
1008856397 6:56093397-56093419 AAAGGGATATTGTCCTAGGATGG - Intronic
1009479170 6:64134774-64134796 AGAGAGATTTTGAGAAAGGAAGG + Intronic
1010311275 6:74388939-74388961 AGAGGAATTTTTCCCTAGGAAGG - Intergenic
1010587261 6:77668130-77668152 AGAGGGATTTTGACAAATCAAGG + Intergenic
1010631668 6:78206150-78206172 AGGGAAATTGTGACCCAGGATGG + Intergenic
1012978415 6:105804740-105804762 AGAAAGCTTGTGACCCAGGAGGG + Intergenic
1013119563 6:107129474-107129496 AGCAGGATTCTGACCCATGAAGG + Intergenic
1013496700 6:110704942-110704964 TGAGGGAAAATGACCCAGGATGG + Intronic
1014327105 6:120012187-120012209 AGAGGAATTTTCCCCCAAGATGG - Intergenic
1015138456 6:129901534-129901556 AGAGGAATTTTGTCCCAGGATGG - Intergenic
1015672646 6:135707818-135707840 AGGGGCATTTTAACCAAGGAGGG + Intergenic
1017159915 6:151355182-151355204 AGACGGAGTTTCCCCCAGGATGG + Intronic
1018603633 6:165574954-165574976 AGGGGAATTTTGTCACAGGAGGG - Intronic
1020727002 7:11828379-11828401 AGGTGGATTTTGACTGAGGAAGG - Intronic
1023969568 7:44981010-44981032 AGAGGTCTGTTGACCCAGGAGGG - Intergenic
1024088960 7:45920323-45920345 AGGCGGATTTGGACCAAGGAAGG - Intronic
1027593347 7:80141360-80141382 ACAGGAATTTTGTCCCAGTATGG - Intronic
1031087492 7:117317797-117317819 AGAGAGATTGTTACCTAGGAAGG + Intronic
1032014248 7:128366934-128366956 GGAGTGGTTTTGACTCAGGAGGG + Intergenic
1032061352 7:128727831-128727853 AGAGAGGTTATGACCGAGGAAGG - Intronic
1032297019 7:130648520-130648542 AGAGGAATTTTGCCTCAGGATGG - Intronic
1033234461 7:139626990-139627012 AGAGGGGCTGTGCCCCAGGAAGG + Intronic
1034292843 7:149946253-149946275 AGAGAGAATTTCACCTAGGATGG - Intergenic
1034358376 7:150472246-150472268 AGTGGGACTTTGCTCCAGGATGG + Intronic
1034479579 7:151309085-151309107 TGAGGGATATTGATCCAGGAAGG - Intergenic
1034580035 7:152034074-152034096 AGAGGGAATTTGACCCAACTAGG - Intronic
1034813225 7:154150619-154150641 AGAGAGAATTTCACCTAGGATGG + Intronic
1036511494 8:9404357-9404379 AGAGGGCTTTTGAGCTAGGCTGG + Intergenic
1037131580 8:15413244-15413266 AGAGGAATTTTGCCACAAGATGG - Intergenic
1037684976 8:21130934-21130956 AGAGAGATATTAAGCCAGGAGGG - Intergenic
1038187757 8:25291160-25291182 GGAGGGCTTTAAACCCAGGAGGG + Intronic
1039375444 8:37028125-37028147 AGAGAGATTTTGACTCACAAAGG + Intergenic
1040008586 8:42641962-42641984 AAAGGGAGTTTGACACAGGTTGG - Intergenic
1040781198 8:51111657-51111679 AGAGGTATTTTGAGCAGGGAGGG - Intergenic
1041892004 8:62879706-62879728 AGAGGGACTGTTCCCCAGGAAGG + Intronic
1042124221 8:65521085-65521107 AGATTAATTTTGCCCCAGGATGG + Intergenic
1042537966 8:69878148-69878170 AGAAGGATTTTTCCACAGGATGG - Intergenic
1044028708 8:87207869-87207891 AGAGGGATTTTGACACAGGTAGG - Intronic
1044627193 8:94245595-94245617 AGAGAGATTTTGACACAGAGGGG - Intergenic
1045503731 8:102763145-102763167 AAAGGCATTTCCACCCAGGAGGG - Intergenic
1046980839 8:120335061-120335083 AGAGTGATCCTGACCCAAGAGGG + Intronic
1047083582 8:121491955-121491977 AGAGGAAATTTGTTCCAGGAAGG + Intergenic
1047309890 8:123683124-123683146 AGAGGGATTTGGAGCCATGGAGG + Intronic
1048228486 8:132613798-132613820 GGAGGGATTATTACCCAAGAGGG - Intronic
1048570391 8:135649869-135649891 AAAGGAATTGTGACCCAGAAAGG + Intronic
1048822705 8:138394470-138394492 GCTGGGATTTGGACCCAGGATGG + Intronic
1049618073 8:143584959-143584981 AGAGGAATTTTGCCTCAGGATGG + Intronic
1053469866 9:38338666-38338688 AGGGAGATTTAAACCCAGGATGG - Intergenic
1056194396 9:84215264-84215286 AGGGGAATGTTGCCCCAGGATGG - Intergenic
1056914857 9:90737681-90737703 AGAGGAATTGTGCCCCAGGATGG + Intergenic
1058443996 9:105037620-105037642 AGAGGGATTTGGACAGAGGGAGG + Intergenic
1059670100 9:116483193-116483215 AGAGGGAGTGGGTCCCAGGAAGG - Intronic
1060027668 9:120186602-120186624 ATAGGGAAATTAACCCAGGAGGG - Intergenic
1061368353 9:130184247-130184269 AGAGGGATGCTGAGCCAAGATGG + Intronic
1203582582 Un_KI270746v1:25174-25196 AGAGGGATTGTGAGGCAGGACGG + Intergenic
1203582856 Un_KI270746v1:28644-28666 AGAGGGATTGTGAGGCAGGAAGG + Intergenic
1186270794 X:7886044-7886066 AGAGAGATTTTGACACTGCAAGG + Intergenic
1187249655 X:17585452-17585474 AGCAGCATTTTCACCCAGGATGG + Intronic
1187472095 X:19578763-19578785 AGAAGCATTCTGCCCCAGGAGGG + Intronic
1190114273 X:47615983-47616005 AGAGGAATTGAGACCCAGGAAGG + Intronic
1190581132 X:51893887-51893909 ACAGGGGTTTTGAATCAGGAAGG - Intronic
1191026439 X:55919147-55919169 AGAGAAATTTTGCCCCAGGATGG - Intergenic
1192747199 X:73951139-73951161 AGACGGATTCTCACCCAGGCTGG + Intergenic
1194616424 X:96109553-96109575 AGAGGAATTTTGCCCCAGGATGG - Intergenic
1195634901 X:107102969-107102991 AGAGAAATTTTGCCCCAGGATGG + Intronic
1195958679 X:110362367-110362389 AGAGGGAGTCTGAGTCAGGAGGG - Intronic
1197974623 X:132153597-132153619 AGAGGAATTGTGTCCTAGGATGG + Intergenic
1198369627 X:135977505-135977527 AGTGGAATTTTGAACCAGGTGGG - Intergenic
1199474458 X:148230436-148230458 AGTGGGATTCTGACTCAGGAAGG + Intergenic