ID: 1122501378

View in Genome Browser
Species Human (GRCh38)
Location 14:102202260-102202282
Sequence GAGGAAGGAGCTGCCACAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 539
Summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 491}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122501378_1122501387 20 Left 1122501378 14:102202260-102202282 CCTCCTGTGGCAGCTCCTTCCTC 0: 1
1: 0
2: 3
3: 44
4: 491
Right 1122501387 14:102202303-102202325 GCACTTCTGGGTTGTTTGCTTGG 0: 1
1: 0
2: 2
3: 21
4: 131
1122501378_1122501385 8 Left 1122501378 14:102202260-102202282 CCTCCTGTGGCAGCTCCTTCCTC 0: 1
1: 0
2: 3
3: 44
4: 491
Right 1122501385 14:102202291-102202313 GCTCTCCTCATGGCACTTCTGGG 0: 1
1: 0
2: 0
3: 17
4: 186
1122501378_1122501384 7 Left 1122501378 14:102202260-102202282 CCTCCTGTGGCAGCTCCTTCCTC 0: 1
1: 0
2: 3
3: 44
4: 491
Right 1122501384 14:102202290-102202312 TGCTCTCCTCATGGCACTTCTGG 0: 1
1: 0
2: 0
3: 11
4: 173
1122501378_1122501382 -2 Left 1122501378 14:102202260-102202282 CCTCCTGTGGCAGCTCCTTCCTC 0: 1
1: 0
2: 3
3: 44
4: 491
Right 1122501382 14:102202281-102202303 TCTTCTGCCTGCTCTCCTCATGG 0: 1
1: 0
2: 4
3: 47
4: 480

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122501378 Original CRISPR GAGGAAGGAGCTGCCACAGG AGG (reversed) Intronic
900082579 1:869773-869795 GGGGTTGGAGCTGCCACGGGGGG - Intergenic
900161949 1:1228064-1228086 GAGTGAGGGGCTGCCACAGGTGG - Intronic
900529955 1:3148286-3148308 CAGGACAGAGCAGCCACAGGTGG + Intronic
900577416 1:3390170-3390192 CAGGGAGGAGCTGTCACAGCCGG + Intronic
900935820 1:5765806-5765828 GAGCCAGGAGCTGCCTCTGGAGG + Intergenic
901031168 1:6307789-6307811 GCAGAAGGAACAGCCACAGGTGG + Intronic
901031319 1:6308536-6308558 GCAGAAGGAACAGCCACAGGCGG + Intronic
901475439 1:9486179-9486201 GAGGAAGGAGCAACCAGATGAGG - Intergenic
901536297 1:9884594-9884616 GAGGAAGGTGCTGTCATGGGAGG + Intronic
902513094 1:16976665-16976687 GAGGCAGGAGCTGAGACGGGTGG + Intronic
902799696 1:18821523-18821545 GAGGAAGGCCAGGCCACAGGTGG + Intergenic
902856492 1:19210092-19210114 GATGAAGGAGTTGCCGCAGCTGG - Exonic
902989879 1:20179553-20179575 GAGGGAGAAGCTGACACAGAGGG - Intergenic
902989886 1:20179649-20179671 GAGGGAGAAGCTGACACAGAGGG - Intergenic
902989908 1:20179939-20179961 GAGGGAGAAGCTGACACAGAGGG - Intergenic
903600308 1:24533384-24533406 GAGCAAGCAGATGCCACAGCTGG - Intronic
903875514 1:26471029-26471051 TAGGGAGAAGCTGCCCCAGGAGG + Exonic
903917312 1:26773840-26773862 GGGGAAGGGGCTGCCAGAAGGGG - Exonic
904134021 1:28297122-28297144 GAGGAAGAGGCTGGCACAGTAGG - Intergenic
904340476 1:29830794-29830816 GAGGAAACAGCTGCCTCATGAGG + Intergenic
904877599 1:33668388-33668410 TAGCTAGGGGCTGCCACAGGGGG + Intronic
905433879 1:37943783-37943805 CTGGAAGAAGGTGCCACAGGGGG - Exonic
905632949 1:39529054-39529076 GAGGAAGGAACGGGCACAGCAGG - Intergenic
906103959 1:43280583-43280605 GAGGAATGAGCTGGTACAGAAGG - Intergenic
906146608 1:43564291-43564313 GAGGATGGAGCTGCTGGAGGTGG + Intronic
906197569 1:43938431-43938453 GAGGCAGGAGCTGCAGCCGGGGG + Intergenic
906588638 1:47002950-47002972 GAGGGAAGAGCTGCTACAGCTGG + Intergenic
907578522 1:55550871-55550893 GAGGAAGGGCCACCCACAGGAGG + Intergenic
908779541 1:67677156-67677178 GAAGAAGGAGCTACAACAGATGG - Intergenic
908841277 1:68282410-68282432 GGGGAAGTTGCTGCCACAAGGGG - Intergenic
911285943 1:95992417-95992439 GAGGAAAGAACTGACAGAGGAGG + Intergenic
912955453 1:114152281-114152303 GAGAAAGGGGCTGCCAGAGGCGG - Intronic
914370161 1:147017654-147017676 GGGGAATCAGCTGCCTCAGGAGG - Intergenic
914919908 1:151839607-151839629 GGGGAAGGAGGAGCCAGAGGAGG - Intronic
915147066 1:153801559-153801581 GAGGAAGGAGCTGACACTGCTGG - Intergenic
916481353 1:165217452-165217474 AAGGAAGGAGCAGCCACCTGTGG - Intronic
916573655 1:166048621-166048643 GAGGAAGGGGCATCCACAGAGGG + Intergenic
920013966 1:202890688-202890710 AAGGAAGGAGGAGCCACATGAGG - Intergenic
921431302 1:215069305-215069327 TAGGAAGGAGCTGCCTAAGTTGG + Intronic
922041639 1:221903599-221903621 CAGAAAGGAGCTGCCCCATGTGG - Intergenic
922244009 1:223777221-223777243 GAGGAAGGAGAGGCCGCAGCAGG - Intergenic
922445807 1:225696233-225696255 GAGGAAGGGGCTGCCATGGCTGG + Intergenic
922501038 1:226097031-226097053 GAGCAAGGAGCTCCCTCAGCTGG + Intergenic
922779999 1:228244477-228244499 GAGGCTGGTGCTGCCACAGGCGG + Exonic
922794390 1:228332936-228332958 CAGGTAGGGGCTGCCAGAGGTGG + Exonic
923260604 1:232264450-232264472 AAGGAAGGAGCTTCATCAGGAGG - Intergenic
923672596 1:236053550-236053572 GTGGAAGGAGCTTCCACTGGAGG - Intronic
923893614 1:238243132-238243154 CAGGAAGAAGCAGCCACAGGAGG - Intergenic
924441226 1:244087085-244087107 GGAGAAGGAGCAGCCACAGATGG - Intergenic
924567015 1:245207427-245207449 GCGGGAAGAGCTGCCACAGCAGG + Intronic
924711710 1:246534945-246534967 GAGGAAGGAGCTGCCTGTTGAGG - Intergenic
1062760041 10:11310-11332 GGGGTTGGAGCTGCCACGGGGGG - Intergenic
1063379940 10:5577992-5578014 GGGGACGGAGGTGCCAGAGGAGG - Intergenic
1065773821 10:29101357-29101379 CAGGATGGAGCAGCCACAGGAGG + Intergenic
1066703316 10:38152484-38152506 GAGGAAGAAGCTTCCACAGTAGG - Intergenic
1066987467 10:42480732-42480754 GAGGAAGAAGCTTCCACAGTAGG + Intergenic
1067031338 10:42880151-42880173 GCGGGAGGAGCAGCCACAGCGGG + Intergenic
1068310327 10:55266417-55266439 GAGGGGGGAGATGACACAGGAGG + Intronic
1069033828 10:63627891-63627913 GAGGATGCAGCTGAAACAGGAGG + Intergenic
1069587961 10:69621083-69621105 GAGGAAGATTCTGCAACAGGTGG + Intergenic
1069622771 10:69847994-69848016 GAGGAAGGAGGTGGGCCAGGGGG - Intronic
1070490522 10:76971625-76971647 GAGGAAGCAGGTGGTACAGGGGG - Intronic
1070768949 10:79071139-79071161 GAGCCAGGGGCTTCCACAGGCGG - Intronic
1071598945 10:86946965-86946987 GAGGAAGGGGCTGCAGAAGGAGG + Intronic
1072620854 10:97078338-97078360 AAGGAGGGGGCTGCCACAGGAGG - Intronic
1072796007 10:98355044-98355066 AAGGCAGAAGCTGCCAAAGGTGG - Intergenic
1073282070 10:102361777-102361799 GATGAAGGAGATGGCACTGGAGG + Exonic
1075924656 10:126241102-126241124 GTGAAAGGAGCTGACACAAGGGG + Intronic
1076412836 10:130264121-130264143 GGGGAAGGAGCAGCCAAGGGTGG - Intergenic
1076561893 10:131372260-131372282 GGGGAAGCAGCTCCTACAGGCGG - Intergenic
1076915207 10:133419981-133420003 GAGGAAGGAGCCTTCACAGCAGG - Intronic
1076988609 11:257297-257319 GAGGAGGGAGCTGGCAGGGGTGG + Intergenic
1077182290 11:1222234-1222256 GAGGAAGCAGCTGCTCCGGGGGG - Intergenic
1077392106 11:2304909-2304931 CAGGGAGGAGCTGCCCCAGCTGG - Intronic
1077868631 11:6243103-6243125 GAGGAAGGAGCAGGAACAGAGGG - Intronic
1078495041 11:11809337-11809359 ATGGAATGAGCTGCCCCAGGAGG - Intergenic
1081775590 11:45674217-45674239 GAGGAAGGCCCTGCCCCAGCTGG + Intergenic
1082839963 11:57680855-57680877 GAGGAAGAAGCTTCCATGGGGGG + Intronic
1083664609 11:64267711-64267733 CAGGAAGGAGGGGCCCCAGGAGG - Intronic
1084035687 11:66508878-66508900 GAGGAAGGAAATACTACAGGGGG - Intronic
1084155598 11:67311053-67311075 GAGGAAGGAGCATCCACTGAGGG + Intronic
1084365296 11:68693613-68693635 GAGGTAGATGATGCCACAGGGGG - Intergenic
1084406454 11:68976767-68976789 GGGGAAGAAGAGGCCACAGGGGG + Intergenic
1085170194 11:74443284-74443306 GACATAGGAGCAGCCACAGGAGG - Intergenic
1085533356 11:77204293-77204315 GAGCCAGCAGCTGCCTCAGGAGG - Intronic
1086329931 11:85743872-85743894 GAGGGAGCAGGTGCCACAGAAGG - Intronic
1086482253 11:87254861-87254883 CAGGAATGAGCTGCCACACCAGG - Intronic
1086598422 11:88603246-88603268 GAGGGAGGAGATGCCTCAGAAGG - Intronic
1088347289 11:108841363-108841385 GAGGAAGATGATGACACAGGTGG + Exonic
1089187504 11:116629454-116629476 GAGGCAGGAGCTGTCACTGCAGG - Intergenic
1091750089 12:3016943-3016965 GAGGCAGGAGGGGCCACAGGAGG + Intronic
1091908037 12:4205284-4205306 GAACAAGGAGCTGACAGAGGTGG + Intergenic
1092756073 12:11764681-11764703 GGGGAAGGAGCTACCAGAGCTGG + Intronic
1095742360 12:45621253-45621275 GAGGAAGGAGATGCTGCAGGGGG + Intergenic
1096077844 12:48815898-48815920 GAGGAGGGAGCGGCCAGAGCTGG + Intronic
1096637204 12:52967813-52967835 GTGGATGGTGCTGCCACAGGAGG + Intergenic
1096787029 12:54022927-54022949 GAGGAAGAAGCCGCAATAGGGGG - Intronic
1100613125 12:96208758-96208780 GAGAAAGGAGCTGCAAGGGGAGG + Intronic
1100622184 12:96288327-96288349 GAGGAAGGAACTGCCAACAGAGG + Intronic
1102554632 12:113718975-113718997 CAGGGAGGAGCAGCCCCAGGAGG - Intergenic
1102694506 12:114787661-114787683 AAGCAAGGAGTTGCCACAGCTGG + Intergenic
1102702576 12:114852381-114852403 GAGGAAGGGGCAGCCATAGATGG - Intergenic
1103339976 12:120216036-120216058 GAGGAAGGAGCAGACATGGGTGG + Intronic
1104390985 12:128390462-128390484 GAGGAGGGAGGTGGCAGAGGAGG - Intronic
1104642214 12:130474718-130474740 GAGGAAGCAGCTGCAGCATGGGG + Intronic
1104702436 12:130917503-130917525 GAGGAAGGCACTTCCACAGAAGG + Intergenic
1104934317 12:132356390-132356412 GAGGAGGGAGCTGCCCCACTGGG - Intergenic
1105256881 13:18749671-18749693 GAGGAAAGAGGTGCCACACTCGG + Intergenic
1105259566 13:18769045-18769067 GAGGAAAGAGGTGCCACACCAGG + Intergenic
1106465812 13:30013680-30013702 GAGAAAGGAGTTGACACACGAGG - Intergenic
1106503835 13:30354736-30354758 GAGGCAAGAGGTGCCATAGGAGG - Intergenic
1107562488 13:41571025-41571047 GAGGATGCAGATGACACAGGAGG + Intronic
1111145997 13:84180991-84181013 GAGGAAGGATCTATCAAAGGAGG + Intergenic
1111286381 13:86098683-86098705 GAATTAGGAGTTGCCACAGGTGG - Intergenic
1112180643 13:97076174-97076196 GAAGCAGAGGCTGCCACAGGTGG - Intergenic
1112705047 13:102059269-102059291 GAGGAAAGAGATGCCACACTTGG - Intronic
1113843109 13:113371470-113371492 GAGGAGGGAGGGGCCTCAGGAGG - Intergenic
1113843209 13:113371709-113371731 GAGGAGGGAGGGGCCTCAGGAGG - Intergenic
1113843240 13:113371787-113371809 GAGGATGGAGGGGCCTCAGGAGG - Intergenic
1113843247 13:113371806-113371828 GAGGAGGGAGGGGCCTCAGGAGG - Intergenic
1113843279 13:113371886-113371908 GAGGAGGGAGGGGCCTCAGGAGG - Intergenic
1114671891 14:24415898-24415920 GGGGCAGGAGCTCCCACAGGAGG - Exonic
1115301766 14:31893137-31893159 GAGGAGGCAGGTGCCACAAGGGG + Intergenic
1116968812 14:51043331-51043353 GAGGAAGGAGTTTCCAAAGGGGG + Intronic
1118717681 14:68571920-68571942 GAAGAAGGAGCTACAAGAGGCGG + Intronic
1120397665 14:83988394-83988416 GAAGAAGGAGCACCCCCAGGAGG - Intergenic
1120703267 14:87722091-87722113 CAGGAAGGTGCTTGCACAGGGGG - Intergenic
1121638327 14:95468631-95468653 GAGGAAGGAGCAGGGTCAGGAGG - Intronic
1122067166 14:99181791-99181813 GGGAAGGGAGCTGCCACAGGGGG - Intronic
1122123080 14:99564963-99564985 GTGGCGGCAGCTGCCACAGGGGG + Intronic
1122272618 14:100575119-100575141 GAGGAAGCTGCTGCCCCAGGAGG - Intronic
1122501378 14:102202260-102202282 GAGGAAGGAGCTGCCACAGGAGG - Intronic
1122600309 14:102918045-102918067 GAGGAAGGAGCCGCCACTGGGGG - Intergenic
1122941718 14:104984489-104984511 CAGGAAGGAGCGGGGACAGGAGG + Intergenic
1123021172 14:105398608-105398630 GCGGATGGAGAGGCCACAGGGGG - Exonic
1123034304 14:105465662-105465684 GGGGGAGGAGCAGCCTCAGGCGG + Intronic
1123192320 14:106583178-106583200 GAGGCAGAAGATGTCACAGGAGG - Intergenic
1123665193 15:22603457-22603479 GAGGTTGGAGCTGGCACATGGGG - Intergenic
1123727016 15:23113090-23113112 CAGGCATGAGCTGCCACACGCGG + Intergenic
1123752566 15:23369195-23369217 GAGGTTGGAGCTGGCACATGGGG + Intergenic
1124154782 15:27216311-27216333 AAGGGAGGATCTGCCACAAGTGG + Intronic
1124319024 15:28697879-28697901 GAGGTTGGAGCTGTCACATGGGG - Intergenic
1124538579 15:30566494-30566516 GAGGTTGGAGCTGGCACATGGGG + Intergenic
1125264458 15:37863171-37863193 GGGGAAGGAGCTGGAAAAGGGGG - Intergenic
1125722075 15:41850013-41850035 GAGGAAGGAGCAGCCAGACCTGG - Intronic
1126763714 15:51992871-51992893 GAGGGAGGTGCTCCCAGAGGCGG - Intronic
1128339149 15:66808380-66808402 GAGGAGGAAGCTGCTGCAGGAGG + Intergenic
1128803998 15:70517335-70517357 GTGGCAGGAGCGGGCACAGGTGG - Intergenic
1128998695 15:72315933-72315955 GAGGAAGAGGCTGGCTCAGGGGG + Intronic
1129349999 15:74950429-74950451 GAGGAAAATGCAGCCACAGGAGG - Intergenic
1130056771 15:80533085-80533107 GAGAAAGGAGCAGCCACTGTTGG + Intronic
1130341938 15:83006919-83006941 CAGAAATGACCTGCCACAGGTGG + Intronic
1130722784 15:86405885-86405907 GAGGAAGCAAATGCCAGAGGAGG + Intronic
1130780839 15:87038582-87038604 GAGGAAGGACCTGACAGGGGAGG + Intergenic
1130922184 15:88356999-88357021 GGGGAAGGAGTTACCCCAGGAGG + Intergenic
1131157427 15:90083855-90083877 CAGGAAGGGGCTGCCACGGCAGG - Exonic
1131926129 15:97385871-97385893 GAGGAAGGAGCTACCAAATCAGG + Intergenic
1132185035 15:99796795-99796817 GAGGTTGGAGCTGGCACATGGGG + Intergenic
1132431954 15:101767760-101767782 GAGGTTGGAGCTGGCACATGGGG - Intergenic
1132519024 16:378971-378993 GAGGCTGGAGCTGGCACGGGGGG - Intronic
1132587566 16:712350-712372 CAGGCAGGAGCTGCCACACCCGG + Intronic
1132747441 16:1442917-1442939 GAGGAGGCAGGTGCAACAGGAGG - Exonic
1132929087 16:2449497-2449519 GGGGAAGGTGCTGACATAGGAGG + Intronic
1133109096 16:3535038-3535060 GAGGAAGGGGCAGGCAGAGGAGG + Intronic
1133255029 16:4511522-4511544 GAGGAAGGAGCAGCCACAAGTGG - Exonic
1133275189 16:4634117-4634139 GAGGAAGTCACTGGCACAGGAGG - Intronic
1135135385 16:19883268-19883290 GAGGAAGGAGCCGCCATTTGGGG - Intronic
1135307846 16:21382295-21382317 GAGGATGGAGATGGCAGAGGAGG - Intergenic
1135477336 16:22788476-22788498 TAGGCAGGAGCTACCACACGTGG - Intergenic
1135565423 16:23508028-23508050 GAGAAAGTAGCTGCCTCAGGTGG - Intronic
1135584533 16:23658657-23658679 GGGCAAGAAGCTGCCACTGGTGG + Intronic
1136024683 16:27461975-27461997 CAGGAAGCAGCTGCACCAGGGGG + Intronic
1136304591 16:29361415-29361437 GAGGATGGAGATGGCAGAGGAGG - Intergenic
1136483072 16:30555022-30555044 GAGCAAGGTGCTGGCAGAGGAGG + Exonic
1136622191 16:31436618-31436640 GAGGTTGGAGCGGCCACAGCAGG + Exonic
1137280452 16:46972942-46972964 GAGGGAGGAGCTCCCGCAGCCGG + Intronic
1137564301 16:49523788-49523810 GTGGGGGCAGCTGCCACAGGAGG - Intronic
1137572344 16:49575024-49575046 AAGGATGCAGCTTCCACAGGCGG + Intronic
1137589452 16:49684803-49684825 CAAGAAGGAGCTGCCAAAGTTGG + Intronic
1137613622 16:49834869-49834891 GAGGAAGGAGGGGGCCCAGGAGG + Intronic
1137625210 16:49903431-49903453 GAGGAAGATGCTCCTACAGGTGG - Intergenic
1140690761 16:77481260-77481282 AGGGTAGGAGCTGCCACTGGAGG + Intergenic
1141729110 16:85809933-85809955 GAGGAAGGAGCTGTCACCCCAGG + Intergenic
1142271600 16:89092648-89092670 GAGGAAGGAGCTGGATCTGGGGG - Intronic
1142300981 16:89257600-89257622 GAGGGAGCAGCAGCCACCGGCGG - Intergenic
1142561309 17:811126-811148 GCGGGAGGAGGTGGCACAGGAGG + Intronic
1142687480 17:1586057-1586079 GAGGAAGGCGCTGCGTCATGGGG + Intronic
1144733174 17:17540287-17540309 GAGGAGGGGGCTGCCCCAGGTGG + Intronic
1145312996 17:21710621-21710643 GTGCCAGGTGCTGCCACAGGCGG - Intergenic
1145841892 17:28002037-28002059 GATGGAGGAGCTGACCCAGGAGG + Intergenic
1146843703 17:36170943-36170965 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146856010 17:36258877-36258899 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146864610 17:36329498-36329520 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1146871916 17:36382788-36382810 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146879277 17:36433873-36433895 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146883207 17:36455018-36455040 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1146916755 17:36682890-36682912 GAGGAAGGAGAAGGCACAAGGGG - Intergenic
1147067470 17:37930086-37930108 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147074802 17:37983412-37983434 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147079001 17:38009647-38009669 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147086325 17:38062958-38062980 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147094938 17:38133582-38133604 GATGAAGGAGTCGCCCCAGGAGG + Intergenic
1147102271 17:38186921-38186943 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147240602 17:39088085-39088107 GAGGAGGGAGCTGGCCAAGGAGG - Intronic
1148860355 17:50601341-50601363 GAGGCAGGAGAGGACACAGGGGG - Intronic
1149330401 17:55575650-55575672 GAGGAAGGAGACACCAGAGGGGG + Intergenic
1149846859 17:60013428-60013450 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150085207 17:62270005-62270027 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150285498 17:63951621-63951643 GAAGAAGGAGCCGCCCGAGGAGG - Exonic
1150715615 17:67570294-67570316 GAAGAAGGAGCTGCCAAGGATGG + Intronic
1151309519 17:73284954-73284976 GGGGAAGCAGCTGCAGCAGGAGG - Exonic
1152059260 17:78057464-78057486 GGGCAAGGGGCTGCCACCGGGGG - Intronic
1152073376 17:78145003-78145025 GTGGCAGCAGCTCCCACAGGAGG + Intergenic
1152896578 17:82914687-82914709 GGGGAAGGAGCTGCACAAGGAGG - Intronic
1152952949 18:11663-11685 GGGGTTGGAGCTGCCACGGGGGG - Intergenic
1153357384 18:4152396-4152418 GAGGAAGTAGATGTCAGAGGAGG + Intronic
1154426459 18:14275756-14275778 GAGGAAAGAGGTGCCACACCAGG - Intergenic
1154434153 18:14331000-14331022 GAGGAAAGAGGTGCCACACCCGG - Intergenic
1154491561 18:14925903-14925925 GGAGAAGCAGCTGCCACAGAGGG + Intergenic
1156291824 18:35754534-35754556 GATGAAGGAGCTGGCTGAGGTGG + Intergenic
1156696485 18:39773991-39774013 GAGGAAGTAGCTGCCATGGGTGG - Intergenic
1157229500 18:45901071-45901093 GAGGAAATAACTGGCACAGGAGG + Exonic
1157429989 18:47616741-47616763 GAGGAATAAGAAGCCACAGGTGG + Intergenic
1158556504 18:58479574-58479596 CAGGACGGAGGTGCCACATGAGG - Intergenic
1158624186 18:59057381-59057403 GAGGAAGGAGCGCCCCCATGTGG + Intergenic
1159077897 18:63702096-63702118 CAGGAAGCATCTGCCACAGCTGG + Intronic
1159814008 18:73051592-73051614 GAGGAGGGAGCAGGCAGAGGTGG + Intergenic
1160229367 18:77034763-77034785 GAGGCAGGGGCTGCACCAGGTGG - Intronic
1160303168 18:77704820-77704842 GACGGAGAAGTTGCCACAGGTGG + Intergenic
1161390925 19:4019772-4019794 GAAGAGGGGGCTGCCACAGCCGG - Intronic
1161973880 19:7598193-7598215 GAGGGAAGAGATCCCACAGGTGG + Intronic
1162016598 19:7849697-7849719 GAGGACGCAGCTGGGACAGGAGG + Intronic
1162100128 19:8334283-8334305 CCGGCAGAAGCTGCCACAGGAGG + Intronic
1162700839 19:12513601-12513623 GAGGGACGAGCTGCGCCAGGAGG + Intronic
1162905866 19:13823535-13823557 GAAGAAGGAGATGACAGAGGAGG - Intronic
1162958900 19:14114665-14114687 GAGGGAGCAGCGGCCCCAGGGGG - Intronic
1163050988 19:14683370-14683392 GAGGAAGGAGCTGAACAAGGAGG + Intronic
1164156117 19:22598374-22598396 GAGGAAGGAGAATCCACAGGAGG - Intergenic
1164309570 19:24033922-24033944 GTGGCAGGAGCTGCGGCAGGTGG + Intronic
1164399651 19:27893857-27893879 AAGGAAGGATCTGACTCAGGAGG - Intergenic
1164655114 19:29915389-29915411 AAAGAAGGAGCAGCCTCAGGTGG + Intergenic
1164672127 19:30078158-30078180 AAGGAAGGTGTTACCACAGGTGG - Intergenic
1164913200 19:32028700-32028722 GAGGAAGTGGCTGGCAAAGGAGG - Intergenic
1165345637 19:35247753-35247775 GAGTGAGGAGGAGCCACAGGAGG + Intergenic
1165557425 19:36646407-36646429 GAGGTATGAGCTGCCACACCTGG + Intronic
1166571911 19:43802393-43802415 GCGGGAGGAGCTGTCCCAGGTGG - Exonic
1167341292 19:48918090-48918112 GAGGATGGAGCCGTCAAAGGAGG + Intronic
1167498107 19:49830903-49830925 GAGGAAGGAGCAGGGGCAGGAGG - Intronic
1167717718 19:51154560-51154582 GAGGAAGGAGTTGACACTGTTGG + Intergenic
1167822902 19:51945612-51945634 GAGGTCTGAGCTGCCACAGAAGG - Exonic
924998849 2:388020-388042 GAAGAAGGAGCTGCAAGAGGTGG - Intergenic
926122815 2:10254114-10254136 GACGGAGGAGCTGCCAAAGCTGG - Intergenic
926169283 2:10541385-10541407 AAGGAAGGACCTGCCAGAGAAGG + Intergenic
926171075 2:10552962-10552984 CAGGAAGGGGCTGACCCAGGGGG + Intergenic
927079114 2:19610340-19610362 GAGGAAGCAGTGGTCACAGGTGG - Intergenic
927193508 2:20532825-20532847 GAGCCAGTAGCTGCCACAGAGGG - Intergenic
927406818 2:22780133-22780155 TGGGAAGGAGATGCCACAGTAGG + Intergenic
927682131 2:25146670-25146692 GAGGAAGGAACTGATACTGGTGG - Intronic
928288700 2:30018062-30018084 AAGGAAGGAGCTGGGACAAGAGG + Intergenic
928481633 2:31689896-31689918 GAGGAAGGAGCTGCCTGTTGAGG + Intergenic
928944529 2:36760804-36760826 TGGGAAGGGGCTGCCCCAGGGGG - Intronic
930024107 2:47020081-47020103 GGCGGAGGAGCTGACACAGGAGG - Intronic
931270046 2:60693566-60693588 AAGGCAGGAGCACCCACAGGAGG + Intergenic
932460237 2:71877443-71877465 CAGGCATGAGCTGCCGCAGGAGG - Intergenic
933368656 2:81387945-81387967 GAGGAAGGAGCTGCCTGTTGAGG - Intergenic
933917850 2:87014575-87014597 TAAGAAGGAGCTGGCACAGCAGG + Intronic
933947517 2:87299479-87299501 GAGAAAGGAGCTGCTGTAGGAGG + Intergenic
934005145 2:87755339-87755361 TAAGAAGGAGCTGGCACAGCAGG - Intronic
934914034 2:98283891-98283913 GAGGAAGGAGCTGGACTAGGAGG - Intronic
935572430 2:104676081-104676103 GGGGAAGGAGCGCCCATAGGTGG + Intergenic
935768102 2:106389431-106389453 TAAGAAGGAGCTGGCACAGCAGG - Intergenic
936019720 2:108985634-108985656 CAGGAAGGAGCAGACACATGTGG - Intronic
936033106 2:109087757-109087779 GAGGAAGCAGATGCTGCAGGTGG + Intergenic
936332680 2:111562092-111562114 GAGAAAGGAGCTGCTGTAGGAGG - Intergenic
936395270 2:112122194-112122216 GGGGAAAGAGATGCCACAGAAGG + Intergenic
937212378 2:120283110-120283132 CAGGCAGGAGCTGCCACACCTGG - Intronic
937916540 2:127101947-127101969 CAGGAAGAAGGTGCCACATGTGG + Intronic
938128456 2:128691025-128691047 GAGGGAGGAGCTGGCACTGCTGG - Intergenic
938168579 2:129055421-129055443 GAGGAAGGAGGTGCCGCTGTGGG - Intergenic
938215133 2:129504870-129504892 GAGGAAGGAGCTGCCAGGTTTGG - Intergenic
938496821 2:131802080-131802102 GGGGTTGGAGCTGCCACGGGGGG + Intergenic
941819295 2:169828162-169828184 GGGGAGGGTGCAGCCACAGGGGG + Intronic
941974093 2:171384550-171384572 CAGGAATGAGCTACCACAGTTGG - Intronic
945884823 2:215363962-215363984 TAGAAAGGAGCTGGCCCAGGTGG - Intronic
946063725 2:216968247-216968269 GAGGAAGCAGGTGCTGCAGGGGG + Intergenic
947118286 2:226794785-226794807 CATGTAGGAGCAGCCACAGGAGG - Intronic
947671008 2:231935239-231935261 GGGAAAGGAGCTGCCCCTGGCGG + Intergenic
947786995 2:232832032-232832054 GAAACAGGAGCTGCCATAGGTGG + Intronic
947873909 2:233455711-233455733 GAGGAGGGCGAGGCCACAGGGGG - Intronic
947903912 2:233745765-233745787 GAGGAATGAGCTTAGACAGGGGG + Intronic
947905314 2:233757123-233757145 GAGGAATGAGCTTGGACAGGTGG + Intronic
948278645 2:236729356-236729378 TAGGAAGGAGCTGCAGCTGGTGG + Intergenic
948650337 2:239439824-239439846 GAGGAAGGAGGTGGCAGAAGAGG + Intergenic
949051987 2:241902463-241902485 CAGGACGGGGCTGGCACAGGAGG - Intronic
1170450081 20:16473986-16474008 GAGGAAGGAGATGCCAAGGCTGG - Intronic
1170493809 20:16904943-16904965 CAGTATGGAGCTGCCACACGAGG - Intergenic
1171069166 20:22049577-22049599 GAGGAAGGAGCACCAACAGGAGG - Intergenic
1171378034 20:24708599-24708621 GAGGAAGGAGCTGCCACAACTGG + Intergenic
1172774238 20:37397898-37397920 GAGCCCGGAGCTGCCACACGGGG - Intronic
1173067318 20:39725647-39725669 GATCAAGAAGCTGCCACAGATGG + Intergenic
1173378011 20:42507301-42507323 GATGAAGCAGATGCCAGAGGAGG + Intronic
1173783730 20:45777091-45777113 GAGGCAGGTGCGGCCACAGCCGG + Exonic
1173827890 20:46058818-46058840 GAGACAGGAGCTGCCAGATGGGG - Intronic
1173900137 20:46581618-46581640 GAGGAAGTGGCTGCCACCAGGGG + Intronic
1174140966 20:48413337-48413359 GAGCAAGGAGCTGTCAGAGAGGG + Intergenic
1174262883 20:49309888-49309910 GAGGAAGGAGGTGGCTGAGGAGG - Intergenic
1175632386 20:60552604-60552626 GAGGAAGGGGCTGGGACAAGGGG + Intergenic
1175721868 20:61292561-61292583 GAGGCTGGAGCTGCCGCAGAAGG + Intronic
1175933741 20:62505658-62505680 GGGTAAGGAGCTGCCACCCGAGG + Intergenic
1176237406 20:64060050-64060072 CATCAAGGAGCTGCCAGAGGAGG - Intronic
1176313778 21:5222322-5222344 GAGGATGGAGTTCCCACAGTGGG - Intergenic
1176848308 21:13893622-13893644 GAGGAAAGAGGTGCCACACCAGG + Intergenic
1177262700 21:18750672-18750694 GAGCAAGCAGCTTCCACAGCTGG - Intergenic
1178704379 21:34861307-34861329 GAGGAAGATGCTGCCGCAGAGGG + Intronic
1179094482 21:38299983-38300005 GAGGAAGGGGCTCTCAGAGGAGG - Exonic
1179305754 21:40152723-40152745 GATGATGCATCTGCCACAGGCGG - Intronic
1179548257 21:42126377-42126399 GAGGAACGACCTGTCCCAGGAGG + Exonic
1179878661 21:44284414-44284436 GAGGAAGGTGGGGCCAGAGGTGG - Intergenic
1180003140 21:45004161-45004183 GAGCCAGGAGTTGCCACGGGAGG + Intergenic
1180183995 21:46130527-46130549 GATGAAGGATCCTCCACAGGAGG + Intronic
1180631652 22:17234160-17234182 GAGGAAGGAGACTCCAGAGGAGG + Intergenic
1180867120 22:19126089-19126111 GAGGAAGCCGCTGCCTCAGAAGG + Intergenic
1181044507 22:20208166-20208188 CAGGAATGAGCTGGCACTGGAGG - Intergenic
1181403981 22:22668853-22668875 GAGGAAGAAGGTGACACAGATGG - Intergenic
1181406745 22:22690349-22690371 GAGGAAAGAGCTGTCGCAGAGGG + Intergenic
1181631115 22:24151881-24151903 GAGGAAGGATGGGCCACTGGAGG - Intronic
1181878011 22:25955217-25955239 GGGGGAGGAGCTTTCACAGGCGG + Exonic
1182577078 22:31280244-31280266 AAGGAAGGGGCTGCCTCAGGTGG - Intergenic
1182675527 22:32036215-32036237 GGGGAAGGAGCTGCTGGAGGGGG - Intergenic
1182835510 22:33338291-33338313 AAGGAAGGAGGTGCCACTGCTGG - Intronic
1183284551 22:36953743-36953765 CAGGCAGGTGCTGGCACAGGTGG + Intergenic
1183383936 22:37504224-37504246 GAGGATGGAGCCGGCACTGGGGG + Exonic
1183742383 22:39675957-39675979 CAGGCAGCAGGTGCCACAGGAGG + Intronic
1183993784 22:41617997-41618019 GAGGAAGAAGTAGCCACAGGAGG - Intronic
1184022221 22:41828444-41828466 GAGGAAGGAGGTGCCAGAAGGGG - Intergenic
1184130874 22:42515707-42515729 GGGGAAGGAGCTCCCTCAGTGGG + Intronic
1184141050 22:42577537-42577559 GGGGAAGGAGCTCCCTCAGTGGG + Intergenic
1184247155 22:43241560-43241582 GGGGGAGGAGCTGCTAGAGGAGG - Intronic
1184558164 22:45244798-45244820 CAGGCATGAGCTGCCACATGGGG + Intergenic
1184837569 22:47032923-47032945 GAGGAAGGAGGGGCCACACAGGG - Intronic
1184869069 22:47222113-47222135 GGGGAAGGAGCTAGGACAGGAGG - Intergenic
1185390559 22:50559024-50559046 AGGGAAGGAACTACCACAGGTGG - Intronic
949535088 3:4989333-4989355 GAGGAAGGGGCTGTCATTGGTGG - Intergenic
950026753 3:9825518-9825540 TAGGAAGGGGGTGGCACAGGTGG + Intronic
952698044 3:36293446-36293468 GAGACAGGAGCAGCAACAGGAGG - Intergenic
952754892 3:36857419-36857441 GAGGCAGGAGCTGGCAAAGAAGG - Exonic
952858922 3:37795960-37795982 GAGGAATGAGAAGCCACTGGAGG - Intronic
952945538 3:38476110-38476132 GAGTATGGAGATGCCAAAGGAGG - Intronic
953413803 3:42704186-42704208 GAAGAAGGACCTGGCACATGAGG + Intronic
954367049 3:50151764-50151786 GAGGAGGAGGCTGCCCCAGGAGG + Intergenic
954373887 3:50184288-50184310 GAGGAAGGAGATGACAGGGGTGG + Intronic
956123537 3:65990109-65990131 GAGGAAGTAGCAGACACAGGAGG + Intronic
957822942 3:85401483-85401505 GAAGATGGAGGGGCCACAGGAGG + Intronic
959650536 3:108746328-108746350 GAGGAAGGAGCTGCTGAAGATGG + Intronic
960465298 3:117990360-117990382 GAGGAAGGAGATATCACAGGAGG + Intergenic
961634424 3:128323927-128323949 GAGGGAGCCCCTGCCACAGGGGG - Intronic
962029668 3:131586547-131586569 GTGGAAGGAGATGTAACAGGAGG - Intronic
962331543 3:134483493-134483515 GAGGAAGGAGCTACCCCAAAGGG - Intronic
962841685 3:139238459-139238481 CAGAAGGGAGCTGGCACAGGGGG - Intronic
964203036 3:154139596-154139618 GAGGAAGGAGACCCCACAAGAGG - Intronic
965719097 3:171641621-171641643 GAGAATGGAGCTGCTGCAGGAGG - Intronic
966775747 3:183541375-183541397 GAAGGAGGAGCTGCCACAGTTGG + Intronic
966992852 3:185252038-185252060 GAGGATGGGGGTGGCACAGGTGG + Intronic
967815571 3:193795672-193795694 GAGGCAGGAGTGGACACAGGTGG - Intergenic
968534039 4:1112858-1112880 GAGGAAGGGGACGCCAGAGGAGG - Intronic
969049851 4:4365023-4365045 GAGGAAGGAGTTGCCACCTGAGG - Intronic
970645026 4:18109857-18109879 GAGGAAGGAGCTGCACAAAGTGG - Intergenic
971231755 4:24805854-24805876 GAGAAAGCAGCTGACACAGCAGG + Intergenic
971446641 4:26757378-26757400 TTGGAAGGAGATGGCACAGGAGG - Intergenic
972035488 4:34514468-34514490 GAGGAAGGAACTGTCAGAGCGGG - Intergenic
972383836 4:38544450-38544472 GAGAATAGAACTGCCACAGGAGG - Intergenic
973849297 4:54945512-54945534 AAGGAAGGATCTGGCAGAGGAGG + Intergenic
974129105 4:57730884-57730906 GTGAAAGAAGCTGCCACAGTGGG - Intergenic
977285875 4:95106170-95106192 GTGGTAGGAGCTGAGACAGGAGG + Intronic
980131447 4:128819874-128819896 GAGGAGGTGGCTGGCACAGGAGG + Intronic
980966270 4:139524427-139524449 GAGCAGGAAGCTGCCACTGGAGG + Intronic
981328127 4:143476001-143476023 GCTGAAGGATCTGCCTCAGGTGG + Intergenic
982115712 4:152096863-152096885 GAGGAAGCAGCTTCCACACTAGG + Intergenic
983132507 4:164038724-164038746 TAGGATGGAGCTGACACAAGTGG - Intronic
983168770 4:164512210-164512232 GAGGAAAGAGGTGCAAGAGGAGG - Intergenic
985495354 5:201186-201208 GAGGAAGCAGCTGCCACTCATGG + Exonic
985644815 5:1079928-1079950 GAGCAAGGTGGTGCCACAGCGGG - Intronic
985653855 5:1119882-1119904 GAGGCAGAAGCAGCCACAGGGGG - Intergenic
985723923 5:1505846-1505868 GAGGAAGGAGCTGGTGCAGAGGG - Intronic
986296821 5:6446323-6446345 AAGCACGGAGCTGGCACAGGGGG + Intergenic
986663104 5:10076515-10076537 GCGGGAGGAGCTCCCAGAGGAGG - Intergenic
987323546 5:16792532-16792554 GAGGACAGAGGTGCCAGAGGAGG - Intronic
987715340 5:21561671-21561693 CAGGCATGATCTGCCACAGGTGG + Intergenic
987887543 5:23831143-23831165 GGGGATGGAGCTCCCAGAGGAGG + Intergenic
989758992 5:44989513-44989535 GATCAAGAAGCTGTCACAGGTGG + Intergenic
992280093 5:75166190-75166212 CAGGCAGGAGCTGCCACACCTGG - Intronic
997281851 5:132653995-132654017 GACAAAGAAACTGCCACAGGAGG + Intergenic
998174766 5:139894973-139894995 GAGGCAGAAGCTGCACCAGGAGG + Intronic
998304312 5:141058253-141058275 GAGTAAGGAACTGTCACAGGTGG - Intergenic
998376645 5:141695248-141695270 CAGGAAGGACCTGCCTCAGACGG + Intergenic
998552893 5:143094257-143094279 AAGGAAGGAGATGCCACGGGAGG - Intronic
1000713642 5:164612264-164612286 GAGGAAAGCACTGGCACAGGTGG - Intergenic
1001084587 5:168691518-168691540 GAGGCTGGAGATGCCACTGGTGG + Intronic
1001551608 5:172606520-172606542 GAGGAAATAGCTGACCCAGGAGG - Intergenic
1001746532 5:174096751-174096773 GAGGCAGAAGCTGCCAGAGCTGG + Intronic
1001830846 5:174788161-174788183 GAGTAAGGGGCTGCCTCTGGTGG + Intergenic
1002443626 5:179276788-179276810 GAAGATGGAGCTGCCATAAGGGG - Intronic
1002493831 5:179598785-179598807 CAGGATGGAGCTGCAACAAGTGG + Exonic
1003057301 6:2833732-2833754 GAGGCGGCAGCTGCCACAGCAGG - Exonic
1003128313 6:3373697-3373719 GAGGAAGCAGCAGCAACAGCAGG + Intronic
1003907738 6:10718153-10718175 AAGGTAGGTGCTGCCACAAGTGG + Intergenic
1004070891 6:12296370-12296392 GAGGAAGGAGATTCCACACAGGG + Exonic
1005857875 6:29876987-29877009 GATGAAGAAGCTGTCACAGATGG - Intergenic
1006082065 6:31573380-31573402 GACGAAGTAGATGCCACTGGTGG - Exonic
1006180478 6:32150807-32150829 GAGGAAGGGGCTGCCTGTGGCGG + Exonic
1007072529 6:39048081-39048103 GAGGCTGGAGCTGCAAGAGGTGG + Intergenic
1007095822 6:39212419-39212441 GAGGCAGGCTCTGCCAAAGGAGG - Intronic
1007209993 6:40185736-40185758 CAGGAAGGGGCTGCCTCTGGAGG + Intergenic
1007690184 6:43695795-43695817 GAGGCAGGAGCTCTAACAGGAGG - Intergenic
1009735785 6:67674618-67674640 GATGAAAGAACTGCCTCAGGGGG + Intergenic
1011633507 6:89349864-89349886 GATGAAGAAGCTGCCAAAGGAGG + Intronic
1011809381 6:91112945-91112967 AAGGAAGGGGCAGCCTCAGGTGG - Intergenic
1012414632 6:98999840-98999862 GAAGATAGAGCTTCCACAGGTGG + Intergenic
1014515426 6:122372293-122372315 AGGAAAGAAGCTGCCACAGGAGG - Intergenic
1017689520 6:156949562-156949584 GAGCAAGGAACTGGAACAGGCGG + Intronic
1018128946 6:160709605-160709627 TAAGAAGGAGCTGGCACAGCAGG - Intronic
1018854229 6:167663974-167663996 GAGGATGCAGCGGCCACAGCGGG - Intergenic
1018946156 6:168347952-168347974 GAGGAAGGGGCTGGGACAGCAGG - Intergenic
1018946168 6:168347993-168348015 GAGGAAGGGGCTGGGACAGCAGG - Intergenic
1018946180 6:168348034-168348056 GAGGAAGGGGCTGGGACAGCAGG - Intergenic
1018946192 6:168348075-168348097 GAGGAAGGGGCTGGGACAGCAGG - Intergenic
1019128683 6:169858547-169858569 GAGGGTGGAGCTGCCACAACAGG + Intergenic
1019164726 6:170090696-170090718 TAGGAAGGGGCTGGCACAGTGGG - Intergenic
1019385469 7:753299-753321 CAGAAAGGAGCGGGCACAGGCGG + Intronic
1019621953 7:1996710-1996732 GAGCAAGGAGCAGGCACAGAGGG + Intronic
1019738816 7:2662920-2662942 CAGGCAGGTGCTGCCCCAGGAGG + Exonic
1020979951 7:15054514-15054536 GAGGAAGGGGCTGCCAGTGAAGG - Intergenic
1022536525 7:31101994-31102016 AAGGAAGGAGGAGACACAGGGGG - Intronic
1022850564 7:34257328-34257350 GGGGAAAGAGAAGCCACAGGGGG - Intergenic
1023009285 7:35911125-35911147 GACCAAGAAGCTGCCACAGATGG + Intergenic
1023436292 7:40143759-40143781 GAGGAAGGTGCAGGCACTGGGGG + Intronic
1024044810 7:45579362-45579384 GAGGAAGGCCCAGCCAGAGGAGG - Intronic
1024549761 7:50552926-50552948 GAGACAGGAGATGGCACAGGTGG - Intronic
1024591966 7:50894595-50894617 GAGGAAGGAGGAGCCACAAGAGG + Intergenic
1025058648 7:55785515-55785537 GGAGAAGGAGAGGCCACAGGTGG + Intergenic
1025122957 7:56321277-56321299 GACCAAGAAGCTGCCACAGATGG + Intergenic
1025175904 7:56802357-56802379 GAGGAAGGAGGTGGGCCAGGAGG + Intergenic
1025176333 7:56804207-56804229 GAGGCAGGAGCTGGCCCTGGAGG - Intergenic
1025177564 7:56809805-56809827 GAGGCAGGAGCTGACCCCGGAGG + Intergenic
1025220482 7:57103430-57103452 GGAGAAGGAGAGGCCACAGGTGG + Intergenic
1025694194 7:63766434-63766456 GAGGCAGGAGCTGGCCCCGGAGG - Intergenic
1025695460 7:63772215-63772237 GAGGCAGGAGCTGGCCCTGGAGG + Intergenic
1025695889 7:63774065-63774087 GAGGAAGGAGGTGGGCCAGGAGG - Intergenic
1025871720 7:65440604-65440626 CATGAAGATGCTGCCACAGGTGG - Intergenic
1026006197 7:66602114-66602136 AAAGAAGGAGAGGCCACAGGTGG + Intergenic
1026915325 7:74116593-74116615 GAGGAGGGGGCAGCAACAGGAGG - Intronic
1027246788 7:76373142-76373164 GAGGGAGGAGCTGATACTGGTGG + Intergenic
1028970925 7:96858277-96858299 TGGGAAGGACCTGCCACAGAAGG - Intergenic
1029545928 7:101210594-101210616 GCGGATGGAGCTGCCCCAGAGGG - Exonic
1029983034 7:104896712-104896734 GAGCAGGGAGAGGCCACAGGAGG + Intronic
1032502307 7:132409336-132409358 GGGGCTGGAGCTGCCATAGGGGG - Intronic
1032802340 7:135327019-135327041 GGGGATGGAGCTGGCACATGTGG + Intergenic
1033282064 7:140013353-140013375 GAGGAAGTCACTGACACAGGTGG + Intronic
1033478140 7:141710733-141710755 GGGGAAGGAGCTGCTACACTTGG + Intronic
1033544777 7:142389836-142389858 GAGGATGGTGCTGCTTCAGGAGG + Intergenic
1033933405 7:146552283-146552305 GAGGAAGGAACTGTTGCAGGTGG - Intronic
1034275511 7:149822135-149822157 GAGGAAGGTGCTGTTGCAGGTGG - Intergenic
1034737360 7:153441372-153441394 CAGGGAGGGGCTCCCACAGGCGG - Intergenic
1035595436 8:853924-853946 GAGGGTGGGGCCGCCACAGGTGG + Intergenic
1036653222 8:10659066-10659088 CAGCAAGGAGCTGCCAATGGTGG - Intronic
1036685144 8:10904593-10904615 GAGCAAGGAGGTGCCACGGAAGG + Intronic
1037530653 8:19769563-19769585 GAGGAAGGACTTGACTCAGGAGG + Intergenic
1037570020 8:20149985-20150007 GAGGAATCAGCTGACTCAGGAGG + Intronic
1037804429 8:22051104-22051126 GAGCATGGAGTAGCCACAGGGGG + Intronic
1037950890 8:23018223-23018245 AAGGAAGCAGCTGGGACAGGTGG + Exonic
1038288881 8:26230839-26230861 GGGGAAGGACCTGCCCCATGAGG - Intergenic
1038398117 8:27261934-27261956 GAGGGTGGAGCTGGAACAGGGGG + Intergenic
1038442983 8:27584618-27584640 GAGGCAGGAGCTGCGATGGGAGG + Intergenic
1040022559 8:42753958-42753980 GAGGCAGGGGGTGCCACTGGGGG + Intronic
1040483817 8:47851770-47851792 GGAGAGGGGGCTGCCACAGGAGG + Intronic
1042228528 8:66534197-66534219 GGGGAAGGACCTTTCACAGGGGG + Intergenic
1044096478 8:88072465-88072487 GAGGAAAGAGTTGCCACAGCAGG + Intronic
1044132364 8:88540028-88540050 GAGGATGGAGTTGCCCCAGAAGG - Intergenic
1044728148 8:95209384-95209406 CAGGAGGGAGCAGCCCCAGGAGG - Intergenic
1045108535 8:98917622-98917644 GATGAAGGAGCTGCCAGATCCGG - Intronic
1045589107 8:103573339-103573361 CAGGCATGAGCTACCACAGGTGG + Intronic
1046832744 8:118764157-118764179 GATGCAGGAGCTGCCACAATAGG - Intergenic
1046844620 8:118902174-118902196 GAGGATGGAGCAGCCATTGGGGG - Intergenic
1047445965 8:124919897-124919919 GAGGAAGGAGCTGCTACCCATGG + Intergenic
1047567986 8:126067085-126067107 GAGAGATGAGCTGCCAGAGGCGG + Intergenic
1048380676 8:133862397-133862419 CAGGAAGGAGCCGACAGAGGTGG + Intergenic
1048920312 8:139223768-139223790 GGGGATGGATCAGCCACAGGGGG + Intergenic
1049040660 8:140110236-140110258 CAGGGGGGAGCTGCTACAGGGGG - Intronic
1049040685 8:140110318-140110340 CAGGAGGGAGCTGCTGCAGGAGG - Intronic
1049040688 8:140110334-140110356 CAGGAGGGAGCTGCTGCAGGAGG - Intronic
1049040719 8:140110441-140110463 CAGGAGGGAGCTGCTGCAGGAGG - Intronic
1049040722 8:140110457-140110479 CAGGAGGGAGCTGCTGCAGGAGG - Intronic
1049040751 8:140110564-140110586 CAGGAGGGAGCTGCTGCAGGAGG - Intronic
1049040754 8:140110580-140110602 CAGGAGGGAGCTGCTGCAGGAGG - Intronic
1049237026 8:141517568-141517590 GAGGGAGGTGCGGCCCCAGGAGG - Intronic
1049264787 8:141661844-141661866 GAGGATGGAGCAGCCACAGAAGG + Intergenic
1049321181 8:141997278-141997300 GAGGAAGGAACCGCCACAAAAGG + Intergenic
1049558657 8:143296577-143296599 GAGGAAGGAGCTGCGGCTGAAGG - Exonic
1049679343 8:143910715-143910737 GGGCAAGGAGCTGGCAAAGGGGG - Intergenic
1049825062 8:144662735-144662757 GAGGAGGGAGCTGGCCAAGGTGG - Intergenic
1049830804 8:144699810-144699832 GAGGAAGGCGCTGTGACTGGGGG - Intergenic
1051951712 9:22643047-22643069 GAGGTAGTAGCTGCCAAAGATGG - Intergenic
1054380965 9:64488689-64488711 GAGGAAGGAGCGGGCAGTGGTGG + Intergenic
1054794589 9:69288567-69288589 GAGGATGGAGCAGCCAGAGAAGG - Intergenic
1057130548 9:92651458-92651480 GGGGAAGGTGATGCCACAGAAGG + Intronic
1057263762 9:93600700-93600722 CAGGAAGCAGCTGGCACTGGGGG + Intronic
1057604538 9:96489567-96489589 TGGGAAGGAGGGGCCACAGGAGG - Intronic
1058101054 9:100917932-100917954 GAGGCAGGAGTTACCACAGGAGG - Intergenic
1058729561 9:107836843-107836865 TCTGAAGGAGCTGCCAAAGGTGG + Intergenic
1059462572 9:114443428-114443450 GAGGAAGGGGCTACCAAAGTAGG - Intronic
1059703726 9:116800566-116800588 GAGGACCCAGGTGCCACAGGGGG - Intronic
1059889449 9:118785215-118785237 GAAGAAGGAGCCCCCACATGGGG - Intergenic
1060735081 9:126061635-126061657 GAGGTCGGAGCTGCCCCTGGAGG - Intergenic
1061062173 9:128255978-128256000 GAGGTTGGAGCTGGCACATGGGG - Exonic
1061362563 9:130152984-130153006 GAGGATGGAGCTGTCACAAATGG - Intergenic
1061510319 9:131057062-131057084 CAAGAGGGAGATGCCACAGGGGG + Exonic
1061673025 9:132199817-132199839 CAAGAAAGAGCTGCCACAGCAGG - Intronic
1061851470 9:133418361-133418383 GAGCAAGGAGCAGCCCAAGGCGG - Intronic
1061918625 9:133770069-133770091 GCGCATGGAGCTGTCACAGGTGG - Intronic
1062078788 9:134607589-134607611 CAGGAAGGTGCTGAGACAGGAGG - Intergenic
1062086580 9:134652356-134652378 GGGCAAGGAGATGCCCCAGGTGG + Intronic
1062279968 9:135747449-135747471 GAGGCGGGAGCTGCCCCCGGGGG - Intronic
1062478756 9:136742043-136742065 GGGACAGGAGCTGCCACCGGGGG + Intronic
1062533466 9:137011598-137011620 GAGGGGGGAGCGGCCTCAGGTGG - Intronic
1189497132 X:41518968-41518990 GAGGAAGGAGAGACCACAGGTGG + Intronic
1189933461 X:46039566-46039588 GAGGAAGGAACTGGCAAAGGAGG + Intergenic
1190740048 X:53282613-53282635 GAGGAACCAGCTGCCCCAGCAGG - Intronic
1191936686 X:66434534-66434556 AAGGCAGGAGCTGTCACTGGAGG + Intergenic
1192548037 X:72029544-72029566 GAGGCAGGAGCAGCCACAGTGGG - Intergenic
1193221767 X:78934973-78934995 GAGGAAGGGGCTGCGGGAGGGGG + Intergenic
1194279569 X:91932374-91932396 GAGGTAGGAGGTGAGACAGGGGG + Intronic
1198321478 X:135521837-135521859 GAGGAAGGAGGGGCCAGAGGAGG - Intronic
1200002339 X:153068548-153068570 GAGGAAGCTGCTGCCACAGAAGG + Intergenic
1200005385 X:153081462-153081484 GAGGAAGCTGCTGCCACAGAAGG - Intergenic
1200110423 X:153738036-153738058 GAGGAGGGGGCCGGCACAGGTGG + Intronic
1200114303 X:153763390-153763412 GTGGATGGCCCTGCCACAGGGGG + Intergenic
1200597045 Y:5155865-5155887 GAGGTAGGAGGTGAGACAGGGGG + Intronic
1201857148 Y:18557284-18557306 GATCAAGAAGCTGCCACAGATGG - Intronic
1201876173 Y:18763096-18763118 GATCAAGAAGCTGCCACAGATGG + Intronic