ID: 1122502747

View in Genome Browser
Species Human (GRCh38)
Location 14:102212258-102212280
Sequence GTACACTCCTTGGCAAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 84}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122502747_1122502751 9 Left 1122502747 14:102212258-102212280 CCAGTTTTTGCCAAGGAGTGTAC 0: 1
1: 0
2: 0
3: 5
4: 84
Right 1122502751 14:102212290-102212312 TGTCTGTCTGGTACCTTGTCTGG 0: 1
1: 0
2: 0
3: 16
4: 143
1122502747_1122502749 -3 Left 1122502747 14:102212258-102212280 CCAGTTTTTGCCAAGGAGTGTAC 0: 1
1: 0
2: 0
3: 5
4: 84
Right 1122502749 14:102212278-102212300 TACTGTCCTTAATGTCTGTCTGG 0: 1
1: 0
2: 0
3: 10
4: 110
1122502747_1122502752 10 Left 1122502747 14:102212258-102212280 CCAGTTTTTGCCAAGGAGTGTAC 0: 1
1: 0
2: 0
3: 5
4: 84
Right 1122502752 14:102212291-102212313 GTCTGTCTGGTACCTTGTCTGGG 0: 1
1: 0
2: 1
3: 10
4: 114
1122502747_1122502753 11 Left 1122502747 14:102212258-102212280 CCAGTTTTTGCCAAGGAGTGTAC 0: 1
1: 0
2: 0
3: 5
4: 84
Right 1122502753 14:102212292-102212314 TCTGTCTGGTACCTTGTCTGGGG 0: 1
1: 0
2: 0
3: 17
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122502747 Original CRISPR GTACACTCCTTGGCAAAAAC TGG (reversed) Intronic
901101829 1:6725107-6725129 GTTTAGTCATTGGCAAAAACAGG + Intergenic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
909442393 1:75712161-75712183 GTACACTACATGGTAAAGACTGG + Intergenic
913090623 1:115474389-115474411 ATACCCACCTTGCCAAAAACAGG + Intergenic
916379300 1:164190850-164190872 GTATATTCCATGGCAAAAATGGG + Intergenic
916475912 1:165168839-165168861 GTACACTGACTGGCAAACACTGG + Intergenic
916669737 1:167004035-167004057 GTAAAATCCTTAACAAAAACGGG + Intronic
920592395 1:207232909-207232931 GTACACTCCTTACCTAACACTGG + Intergenic
922231832 1:223693908-223693930 GGACTCTCCCTGGCAAAATCTGG + Intergenic
1067097159 10:43309271-43309293 ACACACTCCTTGACCAAAACAGG - Intergenic
1072042919 10:91626582-91626604 GTCCACTCATTGTCAAAAAGAGG + Intergenic
1073573001 10:104596693-104596715 GTACCCTCCTTGGACAGAACTGG + Intergenic
1077523528 11:3050366-3050388 GCACACTCCCTAGCCAAAACTGG + Intronic
1083183957 11:61007000-61007022 GTACAATCCTGGGCTAAAAGGGG + Intronic
1085186454 11:74579943-74579965 GCACCCTGCTTGGCTAAAACTGG - Intronic
1088925205 11:114294988-114295010 GCTGACTCCTTGGAAAAAACCGG + Intronic
1093458686 12:19388860-19388882 ATACACTCTTTGGCTAAAAGTGG - Intergenic
1094431335 12:30373116-30373138 GGGGACTCCTTGGGAAAAACAGG - Intergenic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1098502359 12:71207566-71207588 TGAGACTCCTTGGAAAAAACAGG + Intronic
1101933684 12:109037750-109037772 CGGCACTCCTTGGCAAAGACTGG - Intronic
1112160590 13:96863250-96863272 GAACACTGCTTGAGAAAAACTGG + Intergenic
1117101369 14:52351785-52351807 TTATGCTCCTTGGCAAAGACTGG - Intergenic
1117566478 14:56999095-56999117 GAACAAGCTTTGGCAAAAACTGG + Intergenic
1120958779 14:90105882-90105904 GTCCAGGCCTTGGCAAAAGCAGG + Intronic
1121003805 14:90473395-90473417 TGGGACTCCTTGGCAAAAACAGG + Intergenic
1122502747 14:102212258-102212280 GTACACTCCTTGGCAAAAACTGG - Intronic
1132251548 15:100339432-100339454 TTAAACACTTTGGCAAAAACAGG + Intronic
1139773627 16:69298951-69298973 GTAAACTCATTGGCATAGACAGG - Intronic
1145114555 17:20197185-20197207 CTGAACTCCTTGGGAAAAACAGG - Intronic
1156349694 18:36293215-36293237 GTACACAACTTGGCACAGACAGG + Intergenic
1157135658 18:45052092-45052114 GTACAGTGCCTGGCACAAACTGG + Intronic
1166118855 19:40672921-40672943 GTCTACTCCTGAGCAAAAACAGG + Intronic
927991435 2:27450225-27450247 GCACCCTCCTGGGCAAAACCTGG + Intronic
931570263 2:63661477-63661499 GTACAATGCATGGCAAAAAGTGG + Intronic
934889027 2:98049524-98049546 CTAGACTCCTTGGGAAAAACAGG + Intergenic
939442521 2:142267803-142267825 ATAGACTCCTTGGCAAAAATAGG + Intergenic
941460149 2:165761088-165761110 GCAGACTCCTTGGCATAAAAAGG - Intronic
945577136 2:211545730-211545752 GTACTTTCCCTGGCAAGAACTGG - Intronic
945912096 2:215661158-215661180 GTAGAGCCCTTGGGAAAAACAGG + Intergenic
1171445089 20:25197018-25197040 TTTCTCTCCTTGGCAAAAACCGG - Intronic
1172962314 20:38807388-38807410 GAACACTCCTTGGCCAATACTGG + Intronic
1173096893 20:40041980-40042002 GTACAGTTCTTGGCATAACCTGG + Intergenic
1174130272 20:48339618-48339640 GTACAGACCTTGGCAACAAGAGG + Intergenic
1175256313 20:57649670-57649692 GTACAAACCTTGGCAAAAAAAGG + Exonic
1177373724 21:20240759-20240781 GTACGCCCCATGGCAAAAGCAGG + Intergenic
1182483736 22:30626815-30626837 TCAGACTCCTTGGCAAAAAACGG + Exonic
1182658307 22:31906893-31906915 GCACACTCCTGGGCAAGAAGTGG - Exonic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
952156557 3:30649712-30649734 GTATACTCCTTGTCAACAGCTGG - Intronic
958179068 3:90034241-90034263 GTAAACTACTTGGGAAAAAAAGG + Intergenic
962290981 3:134136145-134136167 CTACGCTGCCTGGCAAAAACTGG + Intronic
965113810 3:164461354-164461376 ATATACTCCTTGGCAAACATTGG - Intergenic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
970413956 4:15838144-15838166 GTAAAATCTTTGACAAAAACAGG + Exonic
981361325 4:143848893-143848915 GTACACTCATTGGTAAATAAGGG - Intergenic
981372064 4:143969889-143969911 GTACACTCATTGGTAAATAAGGG - Intergenic
981381148 4:144073091-144073113 GTACACTCATTGGTAAATAAGGG - Intergenic
982707275 4:158723755-158723777 GTACAATGCCTGGCATAAACTGG + Intergenic
992509981 5:77423049-77423071 GTACACACAGTGGCAGAAACTGG - Intronic
993988237 5:94622938-94622960 GTACAACCCTTGGGAAAAAGCGG - Intronic
1002835255 6:860311-860333 GTCCACACCTTGGCAGAACCAGG + Intergenic
1005249245 6:23925982-23926004 GCACTCTCCTTGGCAAAGTCTGG + Intergenic
1005935947 6:30521060-30521082 GTACACTCCTGCCCAAATACTGG + Intergenic
1011806647 6:91079901-91079923 CTACACAACTTTGCAAAAACAGG - Intergenic
1015863175 6:137701734-137701756 GTACATTCCTTACCAAAATCTGG + Intergenic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1020371716 7:7439273-7439295 ATACATGCCTTGGCAAGAACTGG - Intronic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1026672313 7:72401064-72401086 GTTGACACCTTAGCAAAAACGGG - Intronic
1031538977 7:122970162-122970184 CTCCTCTCCTTTGCAAAAACAGG - Intergenic
1032518667 7:132525998-132526020 GTACACACCTTGGGAAATGCTGG + Intronic
1037092874 8:14944789-14944811 GTACACTCCTTGACTTAAAATGG - Intronic
1039008814 8:33070598-33070620 GAACACTCATTGGAATAAACAGG + Intergenic
1040807773 8:51412787-51412809 GAACACACCTTGGTATAAACTGG - Intronic
1044807051 8:96019063-96019085 ATACACACCTTAGCAAAAAAAGG - Intergenic
1048865004 8:138753946-138753968 GTATACTCCGTGGTGAAAACAGG + Intronic
1050657902 9:7849035-7849057 CTGGACTCCTTGGTAAAAACAGG + Intronic
1050911745 9:11080307-11080329 ATAAACCCATTGGCAAAAACAGG - Intergenic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1052743485 9:32416435-32416457 AGACACTCCTTGGGAAAAAAGGG - Intronic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1061327778 9:129874675-129874697 GTGCACTCCTTGGCAAGGAAGGG - Exonic
1190366777 X:49702318-49702340 GTAAACTCCGTAGCAAAAGCTGG + Intergenic
1190962784 X:55268819-55268841 CAAGACTCCTTGGGAAAAACAGG + Intronic
1191233547 X:58116329-58116351 ATAGACACCTTGGCAACAACAGG + Intergenic
1195619367 X:106937699-106937721 ATACAGTGGTTGGCAAAAACAGG + Intronic
1197094150 X:122573875-122573897 GTACACCACATGGCAAAAGCAGG + Intergenic