ID: 1122502749

View in Genome Browser
Species Human (GRCh38)
Location 14:102212278-102212300
Sequence TACTGTCCTTAATGTCTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 110}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122502747_1122502749 -3 Left 1122502747 14:102212258-102212280 CCAGTTTTTGCCAAGGAGTGTAC 0: 1
1: 0
2: 0
3: 5
4: 84
Right 1122502749 14:102212278-102212300 TACTGTCCTTAATGTCTGTCTGG 0: 1
1: 0
2: 0
3: 10
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122502749 Original CRISPR TACTGTCCTTAATGTCTGTC TGG Intronic
905498025 1:38410795-38410817 TTCTTTCCTTAATGTCCGTCTGG - Intergenic
905615582 1:39395452-39395474 TGCTGGCCTTAATCTGTGTCTGG + Intronic
906172084 1:43734993-43735015 TTCTATCCTCAAGGTCTGTCTGG - Intronic
911560081 1:99394363-99394385 TCCTGTCCTTAATGTTAATCAGG + Intergenic
911971910 1:104449845-104449867 TACTGGGCTTAATACCTGTCTGG - Intergenic
913168834 1:116213562-116213584 TACTGGCCTGAATGACTGGCTGG - Intergenic
915855537 1:159382600-159382622 TGCTGTCCTTAATTTCTTTCAGG - Intergenic
917778733 1:178367873-178367895 TTCAGTACTTAATGTATGTCCGG - Intronic
918500388 1:185188461-185188483 TACTGTGATATATGTCTGTCTGG + Intronic
1065574955 10:27108476-27108498 TAATGTCCTTAATCTTTATCTGG - Intergenic
1067383790 10:45799845-45799867 TAGTTTTCTTTATGTCTGTCTGG - Intergenic
1070443694 10:76472712-76472734 TACAATCCTTTATTTCTGTCAGG - Intronic
1070642943 10:78182122-78182144 TACTGGCTTTAATGACAGTCAGG + Intergenic
1070826889 10:79396042-79396064 TAGTGTACTTTCTGTCTGTCCGG + Intronic
1074942780 10:118251194-118251216 TACAGTCCTAAATGTCTGTATGG - Intergenic
1076312148 10:129516202-129516224 TTCTGTCTTTGATGTCTGTATGG + Intronic
1076551493 10:131280876-131280898 GACTGTCCTTTTCGTCTGTCAGG + Intronic
1078391326 11:10937981-10938003 TATTGTGCTTATTGTGTGTCAGG - Intergenic
1082767498 11:57181007-57181029 TTCTCTGCTTACTGTCTGTCAGG - Intergenic
1083728238 11:64639618-64639640 TCCTGTACCTGATGTCTGTCTGG - Intronic
1084347396 11:68563600-68563622 TACTGTCTATTCTGTCTGTCTGG - Intronic
1087089557 11:94254545-94254567 TACTGTACTTATAGTGTGTCAGG + Intergenic
1088662130 11:112058211-112058233 TACTGTCCTTACTGTCTCAAAGG + Intronic
1093375812 12:18426601-18426623 TACTCTCCTGAATGTATGACAGG + Intronic
1094118929 12:26948477-26948499 TACTGGCCTTCATTTCTGTTGGG + Intronic
1098522817 12:71452355-71452377 GACTGTCCTTCAAGTCTGCCTGG - Intronic
1100796611 12:98188651-98188673 GGCTCTCCTTAATGTCTGCCTGG + Intergenic
1104135312 12:125931988-125932010 AAATGCCCTTTATGTCTGTCTGG - Intergenic
1104537277 12:129629714-129629736 TACTGAGCTTATTGGCTGTCCGG - Intronic
1111500397 13:89112237-89112259 TACTGTACATAATGTGTGTGAGG + Intergenic
1116761445 14:49020065-49020087 CTCTGTCCTTGCTGTCTGTCAGG - Intergenic
1117205700 14:53441132-53441154 TGGTGTCCTACATGTCTGTCTGG + Intergenic
1122502749 14:102212278-102212300 TACTGTCCTTAATGTCTGTCTGG + Intronic
1132092453 15:98957287-98957309 TTGTGTCCTGAGTGTCTGTCGGG - Exonic
1132381841 15:101371621-101371643 TACAGTCCTTAATTTCCCTCTGG - Intronic
1137512999 16:49117655-49117677 TACTGTCCTTGGTGTCTGGGTGG - Intergenic
1142803740 17:2360968-2360990 TCCTGTCTTTAGAGTCTGTCTGG + Intronic
1144179411 17:12737733-12737755 AACTGTCCCTAATATCTGTATGG - Intronic
1147331853 17:39704015-39704037 CACAGTCCTTCATGTCTCTCTGG - Intronic
1154157822 18:11957824-11957846 GACTGTGCTTTAAGTCTGTCTGG + Intergenic
1156053909 18:32974570-32974592 TACTCTCCTGAGAGTCTGTCTGG + Exonic
1159562047 18:70006452-70006474 TACTGTGCTTGCTGCCTGTCTGG - Exonic
1168576013 19:57510820-57510842 TGCCTTCCTTAATGTCTCTCAGG - Intronic
927059495 2:19402648-19402670 TACTGTACTTAAATTCTTTCTGG + Intergenic
929323887 2:40581703-40581725 TATTTTCCTTTATGTCTGTTTGG - Intronic
930338103 2:50076179-50076201 TACTGCACTTAATGTCTGCCAGG + Intronic
932227278 2:70052586-70052608 TGCTGTCCTTAAATTCTTTCTGG - Intergenic
934959081 2:98652212-98652234 CAGTGTTCTTTATGTCTGTCGGG - Intronic
935589344 2:104831472-104831494 TACAATCCTTCATGTCTGTGTGG - Intergenic
935595226 2:104872811-104872833 TCCTCTCCTTAATGCCAGTCTGG - Intergenic
937550557 2:123084326-123084348 GAAAGTCCTTAATCTCTGTCTGG + Intergenic
943870911 2:192997610-192997632 AACTGTTCTTAATGTCTCTGAGG + Intergenic
944824692 2:203470069-203470091 TACTGATCTTAATGACTGTCAGG - Intronic
947372907 2:229466556-229466578 TACTGTCCATGCTGTCTCTCGGG + Intronic
948972655 2:241441399-241441421 TGCTGTCCTTAAACTCTGGCAGG - Exonic
1169299473 20:4429846-4429868 TCCTGTCCTTAATGTGTTCCAGG + Intergenic
1169562068 20:6812368-6812390 CACCGTCATTAATGTCTGCCTGG + Intergenic
1173077169 20:39830214-39830236 TGCTGGCCTTTATGTCTTTCTGG + Intergenic
1173965716 20:47111000-47111022 TACTGTCCTTCATGGCAGTTTGG + Intronic
1175326430 20:58131818-58131840 TCATGTGTTTAATGTCTGTCTGG - Intergenic
950857630 3:16120508-16120530 TAATGTCCATGATGTCTGTGAGG - Intergenic
958061474 3:88488241-88488263 TTCAGTCCTTAGTGTCTGTTAGG + Intergenic
958577846 3:95975160-95975182 TACTGTACTTAATGTCTCACTGG + Intergenic
959465645 3:106682950-106682972 TCCTATCCTTAATGTCAGTTAGG - Intergenic
959909228 3:111744849-111744871 TTCTGCCCTTACTGTGTGTCAGG - Intronic
961006327 3:123407861-123407883 TAGTCTGCTTAATGTCTGTATGG - Intronic
961657287 3:128450122-128450144 TCCTGTCCTTAATGCCCGGCTGG - Intergenic
962295971 3:134187471-134187493 TAGGGTGCTTAATGTCTATCAGG - Intronic
962614076 3:137106867-137106889 TATTGTCCTTCATCTCTTTCTGG - Intergenic
965982996 3:174715768-174715790 TACTGTCCTTACTTTGTATCTGG + Intronic
972509035 4:39750401-39750423 TAGTTTCCTTCATTTCTGTCTGG + Intronic
973863565 4:55089602-55089624 TCCTGTACTTCATGTCTATCAGG - Intronic
974129819 4:57740351-57740373 TACTGATCTTGATGTCAGTCTGG - Intergenic
975198751 4:71559398-71559420 CAAGGTCCTTAATGTCTGTGAGG - Intronic
975618677 4:76274112-76274134 TACTTTCCTGAATCTCTGTGTGG + Intronic
978370507 4:108025500-108025522 TACTGTACTTACTGTGTGCCAGG - Intronic
981449280 4:144877920-144877942 TATTGTCCTTAATGCCAGCCAGG + Intergenic
986292807 5:6413394-6413416 TCCTCTCCTTTCTGTCTGTCGGG + Intergenic
987522773 5:19008397-19008419 AACTATCCTTTATGTCTGTCAGG - Intergenic
987976169 5:25017997-25018019 TAGTGGCCTTAATTTCTTTCTGG - Intergenic
989354580 5:40529208-40529230 TACTATCCTCAATGTCTATCTGG + Intergenic
991440118 5:66638293-66638315 TATTGTCCTTAAATTCTCTCCGG - Intronic
991479908 5:67067101-67067123 TATAGTCCTCAATGTCTGGCAGG - Intronic
993693665 5:91034687-91034709 GTCTGTCCTTCATGTCTGTGTGG - Intronic
993898173 5:93563591-93563613 TACTTTCTTTCATTTCTGTCTGG - Intergenic
998214657 5:140228090-140228112 AACTAGCCTTAATGTCTATCAGG - Intronic
1005055556 6:21725733-21725755 GACTGGCTTTGATGTCTGTCAGG + Intergenic
1008619756 6:53260160-53260182 AACTGTCTTTAATGTCTGGCAGG + Intergenic
1010494579 6:76517759-76517781 TACTGTCCTTTGTTTCTCTCAGG - Intergenic
1011952901 6:92989792-92989814 TGCTTTCCTTTATGTCTGTAAGG + Intergenic
1013202061 6:107907728-107907750 TACTGTGCTTGCTGTGTGTCAGG - Intronic
1018106227 6:160489543-160489565 TATTTTCCTTCATGTCTGTGAGG + Intergenic
1020195563 7:6035540-6035562 TGCTATTCTGAATGTCTGTCAGG - Exonic
1026957259 7:74385576-74385598 TTCTGTCCTTTATGGCTGTGAGG + Intronic
1028736326 7:94216818-94216840 CACGGTCCTTATTGTCTTTCTGG - Intergenic
1030977768 7:116148130-116148152 TACTGTCTATTATCTCTGTCTGG - Intronic
1031370650 7:120961127-120961149 TCCTGTCCTTATTGTCTTTCAGG + Intronic
1031756489 7:125649774-125649796 TACTTTCCTAATTGTCTGGCTGG - Intergenic
1031816521 7:126444847-126444869 TTTTGTCCTTAATGCCTGACCGG + Intronic
1032714957 7:134500259-134500281 TGCTGTCCTTAATTTCGGTGGGG + Intergenic
1035759697 8:2060800-2060822 TAATGTCCTTAACGAGTGTCAGG - Intronic
1041042896 8:53864827-53864849 AACTGTCATTAATTTCTTTCAGG - Intronic
1043248944 8:78044786-78044808 TTCTGTCTTTTATGTCTGTTTGG + Intergenic
1046689997 8:117272395-117272417 TTATCTCATTAATGTCTGTCTGG - Intergenic
1047111463 8:121793910-121793932 GACTGTCCTTAATGAGAGTCTGG + Intergenic
1048927612 8:139284647-139284669 CACTGTCCTTTGTGTCTGTGAGG + Intergenic
1049071920 8:140362188-140362210 AAGTGTCCTTAATGCCTGGCAGG + Intronic
1050954941 9:11644333-11644355 TACTGTGCTTAATGTTTGAGGGG + Intergenic
1052062699 9:23980369-23980391 CAATGTCCTTATTTTCTGTCTGG - Intergenic
1053102366 9:35381570-35381592 CACTGCCCTGAATGTCTGTGAGG - Exonic
1054848691 9:69823588-69823610 TACTGTTCTTAATATGTGGCAGG - Intronic
1056332225 9:85530216-85530238 TGCTGTCCTTGATGACTGCCAGG - Intergenic
1056498799 9:87188048-87188070 TAATCTCCTTAATGTCCTTCGGG - Intergenic
1056838744 9:89980509-89980531 CCCTGTCCTTAGTGTCTTTCTGG - Intergenic
1059456111 9:114401307-114401329 TTCTGTCCTCAATATTTGTCTGG - Intergenic
1192212152 X:69134523-69134545 TACAGTGCTTCATGTGTGTCAGG - Intergenic
1193057109 X:77164635-77164657 TACTGAGCATAATGTCTTTCAGG - Intergenic
1194157453 X:90409559-90409581 TCTTGTTCTTAATGTCTGGCAGG + Intergenic
1196099953 X:111837561-111837583 TTGTGGCCTTATTGTCTGTCAGG - Intronic
1200503786 Y:3986540-3986562 TCTTGTTCTTAATGTCTGGCAGG + Intergenic
1201157721 Y:11148808-11148830 TATTGTCATTATTGTCTCTCTGG + Intergenic