ID: 1122502751

View in Genome Browser
Species Human (GRCh38)
Location 14:102212290-102212312
Sequence TGTCTGTCTGGTACCTTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 143}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122502748_1122502751 -1 Left 1122502748 14:102212268-102212290 CCAAGGAGTGTACTGTCCTTAAT 0: 1
1: 0
2: 1
3: 6
4: 84
Right 1122502751 14:102212290-102212312 TGTCTGTCTGGTACCTTGTCTGG 0: 1
1: 0
2: 0
3: 16
4: 143
1122502747_1122502751 9 Left 1122502747 14:102212258-102212280 CCAGTTTTTGCCAAGGAGTGTAC 0: 1
1: 0
2: 0
3: 5
4: 84
Right 1122502751 14:102212290-102212312 TGTCTGTCTGGTACCTTGTCTGG 0: 1
1: 0
2: 0
3: 16
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122502751 Original CRISPR TGTCTGTCTGGTACCTTGTC TGG Intronic
900759739 1:4462853-4462875 TGTCTGTCTGCTGCCTGGTGTGG - Intergenic
902359159 1:15932670-15932692 TCTTTCTCTGGTTCCTTGTCTGG - Exonic
903448055 1:23434994-23435016 TGTCTGTCTGATATCTTGGTGGG - Intronic
904794445 1:33048765-33048787 TGTCTCTCAGGGACCTAGTCTGG - Intronic
906199430 1:43949534-43949556 TGGATCTCTGGTACCTTGTCGGG - Exonic
908686256 1:66723183-66723205 TCTCTGTTTGGTACCTTGGCTGG - Intronic
911404808 1:97423321-97423343 TTTCTGTCTGGTTCATAGTCTGG + Intronic
912678162 1:111705632-111705654 TGTGTGTCTGGCACTGTGTCAGG + Intronic
912715307 1:111979412-111979434 TGTGTGTCTGGTACAGTGCCTGG + Intronic
913405484 1:118486300-118486322 TGTCAGCCTGGTGCCATGTCAGG - Intergenic
917615514 1:176739829-176739851 TGTCTGTCTTTTATGTTGTCTGG + Intronic
917767271 1:178235141-178235163 TGTATGTCTGTTTCCTTGCCAGG + Intronic
918656897 1:187038131-187038153 TGCATGTCTGGTACCTTGGTAGG + Intergenic
920656519 1:207879610-207879632 TGACTTTCTGGTTCCTTGCCTGG - Intergenic
920805068 1:209225238-209225260 TCTCTGTCAGGTACTGTGTCAGG - Intergenic
921924611 1:220700994-220701016 TTTCTGTCTGGTCCTTTGGCTGG - Intergenic
922552979 1:226510692-226510714 TGTATGTCTGGTGCCTTGGCAGG - Intergenic
924133300 1:240935244-240935266 TGTCTGTCTACTACATTTTCTGG + Intronic
1063790695 10:9442915-9442937 TTCCTGTCTGGTACATTGTATGG - Intergenic
1065001135 10:21338619-21338641 GGTCTCTCTGTCACCTTGTCTGG + Intergenic
1066053608 10:31660153-31660175 TGTCTGTCTGGTTCCTGGTGGGG - Intergenic
1072553481 10:96496545-96496567 GGTCTGGCTGGTACCTGGGCTGG + Intronic
1073700959 10:105925995-105926017 TGTTTTTCTGGTTCCTTTTCTGG - Intergenic
1074442274 10:113488452-113488474 TGTCTTTGTTGTCCCTTGTCAGG - Intergenic
1075779132 10:125005639-125005661 TGTGTGTCGGGTTCCTCGTCAGG - Intronic
1075998320 10:126895682-126895704 TGTCTTTCTGGTTCCATGGCTGG - Intergenic
1076802410 10:132836659-132836681 TGTCTGTCCGGCACCTTCTTGGG + Intronic
1076891558 10:133287174-133287196 TGTCTGTCTCGCATCTTGTCTGG - Intronic
1079276104 11:19039294-19039316 TTTCTGTTTGGTACCTTTTTAGG - Intergenic
1081398886 11:42619362-42619384 TGTATGTGTGGTACCTGGTGAGG + Intergenic
1082410359 11:52369046-52369068 TGTCTCTCTGTTACCTAGGCTGG + Intergenic
1082877694 11:58004652-58004674 TGTCTTTCTTGTAGCTTCTCTGG + Intergenic
1083116325 11:60463087-60463109 TGACTGTGTGGTACCCTCTCTGG + Exonic
1083550004 11:63580724-63580746 TGTCTGTCTTCTACCTTTTAAGG - Intronic
1084706903 11:70820861-70820883 TGTCTCTCTGCTTCCATGTCAGG - Intronic
1087312805 11:96569564-96569586 TGTGTGCCTGGTACTTTGCCTGG - Intergenic
1087922072 11:103877696-103877718 TGTATGCCTGGTACCTGGCCTGG + Intergenic
1088393945 11:109346733-109346755 TGTCTGTGTGTTGCCTTTTCGGG - Intergenic
1091851244 12:3698890-3698912 TGTCTTCCTGGTACCTTGCCGGG + Intronic
1092068552 12:5613552-5613574 TGTCTGTCTGGTTCCATGGTGGG - Intronic
1094011385 12:25813876-25813898 TGTCTGTTTTGTAGCTTGTTAGG + Intergenic
1095789237 12:46146102-46146124 TGCATGTCTGGCACCTTGACAGG - Intergenic
1096728594 12:53586668-53586690 TGTCTCTCTGATAACTTCTCAGG + Intronic
1097737416 12:63197019-63197041 TTTCTGTCTGTTTCTTTGTCTGG - Intergenic
1106733020 13:32561447-32561469 AGTCTGGCAGGTACCTTGTTTGG + Intergenic
1111953126 13:94726540-94726562 TTTGTGTCTGGCACCTTGGCAGG - Intergenic
1112659885 13:101495773-101495795 TGTCTGTCTGGGACCTGGTAAGG + Intronic
1114598960 14:23938415-23938437 TGTCTGTCTGTTCCCAAGTCAGG - Intergenic
1119748409 14:77060752-77060774 TGTCTCCCTGGTACCTAGTATGG - Intergenic
1121746116 14:96294570-96294592 TGTCTGTCTTTTCCCTTGTGGGG - Intronic
1122502751 14:102212290-102212312 TGTCTGTCTGGTACCTTGTCTGG + Intronic
1123107200 14:105847502-105847524 TGCCTGTCTCTTACCATGTCGGG + Intergenic
1123109857 14:105861300-105861322 TGCCTGTCTCTTACCATGTCGGG + Intergenic
1124137478 15:27048017-27048039 TATCTGTGTTGTACCTTGCCTGG - Intronic
1128345002 15:66848054-66848076 TGTCTGCCAGGTACCATGTAGGG + Intergenic
1129227198 15:74176878-74176900 TGTCTGCCTGGAATTTTGTCTGG + Intergenic
1130166744 15:81469002-81469024 GGTCTGTCTGTTACCTAGGCTGG - Intergenic
1130825132 15:87536244-87536266 AGTCAGTTTGGTACCTTGTTTGG - Intergenic
1133864165 16:9626280-9626302 TCTCTGTCTGTTACCCTGGCTGG - Intergenic
1138896080 16:61206366-61206388 TTTCTGTCTGATACCTCATCAGG - Intergenic
1142219585 16:88847339-88847361 TCTCTGTCTGTTACCTAGGCTGG - Intronic
1142955715 17:3520111-3520133 CATCTGTCTGGTACCTTTTCTGG - Intronic
1144451608 17:15384607-15384629 TGGCTGCCTGGCACCCTGTCAGG + Intergenic
1150432502 17:65129531-65129553 TCTCTGTCTGATAACTTGTGGGG + Intergenic
1150444210 17:65215914-65215936 TGTCTGTCTCTTTCCTAGTCTGG - Intronic
1153149554 18:2075654-2075676 TGTCTCTCTGGGGCCCTGTCTGG - Intergenic
1155566006 18:27135294-27135316 TTTCTGTCTGATTCCTTGGCTGG + Intronic
1156194922 18:34763816-34763838 TATCTGTCTGGTACCCAGTAGGG - Intronic
1158494637 18:57943352-57943374 TGTGTGTCTGCTGCCTTGCCAGG + Intergenic
927439193 2:23098553-23098575 TGTCTGTCTGTTGCTTTTTCAGG - Intergenic
928038525 2:27850026-27850048 TGTCTGACTGCTACCTTGGCTGG + Intronic
929627160 2:43421208-43421230 TGACTGTCTGATACCAGGTCAGG - Intronic
931776894 2:65548686-65548708 TGTCTGTTTGGTAAAATGTCTGG + Intergenic
938144317 2:128821245-128821267 TGTCTGTCTGGGACTTTGGTTGG - Intergenic
938264266 2:129915034-129915056 TGTCTGTCTGTCACTGTGTCTGG - Intergenic
939706644 2:145462296-145462318 TGTCCTTTTGATACCTTGTCAGG - Intergenic
943072684 2:183160415-183160437 TGTCTCTCTGTTACCTAGGCTGG + Intronic
943677796 2:190733404-190733426 TGTGTAACTGATACCTTGTCGGG + Intergenic
944776695 2:202974362-202974384 TGTCTTTCAGGTACCTCATCGGG - Exonic
945640658 2:212424288-212424310 TCTGTGTCTGGTACTGTGTCTGG + Intronic
945849476 2:214988153-214988175 TGTCTGTTTGGACCCTTGTGGGG - Intronic
947924772 2:233911679-233911701 TGTCTGTCTGTCCCCCTGTCTGG + Intergenic
948654104 2:239466075-239466097 TGTCTGCCTGGGACCTTCCCAGG - Intergenic
948732292 2:239974334-239974356 TGTTTGTCTTGTCACTTGTCTGG - Intronic
1169051099 20:2578529-2578551 TTTCTGTTTGGTACATAGTCTGG + Intronic
1171269234 20:23800380-23800402 TCTCTTACTGGTACCTGGTCAGG + Intergenic
1172909635 20:38398180-38398202 TTTCTTTCTGCTATCTTGTCAGG + Intergenic
1174451718 20:50624724-50624746 TGCCCGTCTGGAAGCTTGTCTGG - Intronic
1179780428 21:43696637-43696659 TGTCTGTCTGTGGACTTGTCTGG - Intergenic
1182700700 22:32235234-32235256 TGTCTTTCTGGTACCTCCGCTGG + Intronic
1183579857 22:38717511-38717533 TGTGTGTCTGGTACTATGTGAGG + Intronic
1183722338 22:39569886-39569908 TGTCTGTCCTGTCCCTTCTCTGG + Intergenic
950654193 3:14426648-14426670 TGTCTGTCTGGCACTGTGACGGG - Intronic
951194670 3:19810808-19810830 TTTCTTCCTGGTAGCTTGTCAGG - Intergenic
952216594 3:31284265-31284287 GCACTGTCTGGTACCTTGCCAGG - Intergenic
954485212 3:50843321-50843343 TGTATGTCTGGCATCTTGGCAGG + Intronic
956283208 3:67581021-67581043 TCCCTCTCTGGTACCTTGTAAGG + Intronic
962157803 3:132966948-132966970 TGTCTTTCTGAAACCTTTTCAGG + Intergenic
963822744 3:149916594-149916616 TTTCTTTCTTCTACCTTGTCTGG + Intronic
965559855 3:170050653-170050675 TTTCTGTCTCTTGCCTTGTCTGG + Intronic
967777483 3:193399528-193399550 TGTCTGTCTGGTATTCTGTGTGG + Intergenic
967999053 3:195189325-195189347 TGTTTGTTTTGTAACTTGTCTGG - Intronic
974468926 4:62293468-62293490 TGTCTGTCTTGTTCCTTGGCTGG - Intergenic
975349762 4:73331981-73332003 TTTCTGTCTGCTACTTTGTTGGG + Intergenic
975587369 4:75963743-75963765 TGTCTGTCTGGCACCTGGTGGGG - Intronic
976312609 4:83627450-83627472 TATCTGTATGGTGGCTTGTCTGG + Intergenic
976423909 4:84877790-84877812 TATTTGTCAGGTACCATGTCAGG - Intronic
978652822 4:111027807-111027829 CACATGTCTGGTACCTTGTCTGG - Intergenic
980228795 4:130021336-130021358 TGCTTGTCTGGTACCATATCTGG + Intergenic
982161434 4:152573809-152573831 TATCTGTCTGGTCCATTGGCTGG - Intergenic
982972796 4:162012194-162012216 TCTCTGTCTGTTACCCTGTAGGG - Intronic
985053731 4:186018027-186018049 TAACTGTCTGGTACCTGGTTTGG + Intergenic
986309178 5:6539063-6539085 TGTCTGGCTGGCACAATGTCTGG + Intergenic
988109338 5:26797507-26797529 TGTCTGTCTGGTTTCTAGTCTGG + Intergenic
989809121 5:45651113-45651135 TGTAAATCTGGTACCGTGTCAGG - Intronic
990786086 5:59421914-59421936 TATGTGTCTGGTGCTTTGTCTGG - Intronic
993190821 5:84678215-84678237 TGTCTATCTCCTACATTGTCAGG + Intergenic
994074442 5:95634959-95634981 TGTATGTCTGGTGCCTGGGCTGG + Intergenic
996193539 5:120575307-120575329 TGTGTGTGTGTTTCCTTGTCTGG - Intronic
999182291 5:149678294-149678316 AGTCTGTCTGGGGCCTTGTGAGG - Intergenic
1000792643 5:165626364-165626386 TGTGAGAATGGTACCTTGTCAGG - Intergenic
1001854696 5:175000700-175000722 TGGTTGTCTGGTACCTGGACCGG - Intergenic
1002839311 6:892552-892574 TGTGTGTCTGGCACTTTGCCTGG + Intergenic
1002878843 6:1234614-1234636 TGGCTGGCTGGGGCCTTGTCAGG - Intergenic
1004632239 6:17433120-17433142 TCTCTGTCTGTCACCTTGGCAGG + Intronic
1005190287 6:23213928-23213950 TATATGTCTGGTACCTGGGCTGG + Intergenic
1007216453 6:40243823-40243845 TGTCTGTCTGTTGTCTTTTCTGG + Intergenic
1009977209 6:70683894-70683916 AATCTGTCTGTTACTTTGTCAGG + Intronic
1013010584 6:106116396-106116418 TGACTGTCTTCTGCCTTGTCAGG + Intergenic
1014190577 6:118491604-118491626 TGTCTGTCATTTACCCTGTCAGG - Intronic
1015503419 6:133956325-133956347 TGTATGTCTGGTGCCGTGTCAGG + Intronic
1015777094 6:136824873-136824895 TGTGTCTCTGGTGCCTTGTCTGG + Intronic
1017091155 6:150760300-150760322 TGTCTGTCTGCTTCCTTACCTGG + Intronic
1017723021 6:157257447-157257469 TGTCTCTCTTATACCTTATCAGG - Intergenic
1026129934 7:67611975-67611997 GGTGTGTCTGGTACTTTGGCTGG + Intergenic
1026430874 7:70346125-70346147 TATGTGTCTGGTACTATGTCAGG + Intronic
1030443648 7:109621583-109621605 TGGATGTCTGATACCTTGTTTGG - Intergenic
1032442016 7:131949258-131949280 TGTCTGTCTGGACTCTTGTGGGG + Intergenic
1037096051 8:14989305-14989327 TATCTTTCTGGTACGTTGTTGGG - Intronic
1037179584 8:15989173-15989195 TGTGTGTGTGTTTCCTTGTCTGG + Intergenic
1043589492 8:81811646-81811668 TGTCTGTTTAGTAACTTGCCTGG - Intronic
1045241873 8:100409767-100409789 TGTGTGACTGGTCCCTTATCTGG + Intronic
1045577889 8:103445632-103445654 TGTTTGCCTGGCATCTTGTCAGG + Intergenic
1047808168 8:128380379-128380401 TTTTTGTCTGGTTCCTTTTCAGG + Intergenic
1047885004 8:129240302-129240324 TTTCTTTCTGGTGCCTTTTCAGG - Intergenic
1049660756 8:143818760-143818782 AGTCTGCCTGGGACCTTGGCGGG - Intronic
1055734954 9:79317008-79317030 TGTGTGTCTAATACCTAGTCTGG - Intergenic
1057301910 9:93891458-93891480 TGGCTGTCTGGTACCTGCCCTGG + Intergenic
1060066004 9:120501688-120501710 CATATGTCTGGTACCTTGTCGGG - Intronic
1060856510 9:126917986-126918008 TATCTGTCTAGCACCTTGCCTGG + Intronic
1187263027 X:17704707-17704729 TGTCTCTCTGGGAGCTTTTCAGG - Intronic
1188248340 X:27860322-27860344 TGTCTGTCTTGTACATTGTGGGG + Intergenic
1192190199 X:68986446-68986468 TGTGTGTCTGCTACCTTGGGTGG - Intergenic
1192592119 X:72369006-72369028 TGCCTCACTGGTACATTGTCAGG - Intronic
1194195940 X:90892871-90892893 TGTCTGTCAGTTACCCTGTAAGG - Intergenic
1194815337 X:98433907-98433929 TTTCTTTCAAGTACCTTGTCAGG + Intergenic
1195700994 X:107705649-107705671 TGTGTGTCAGGTACCCTGTGAGG - Intergenic
1198481400 X:137044746-137044768 TGGCTTTCAGGTACCTTGCCTGG + Intergenic
1200541788 Y:4467063-4467085 TGTCTGTCAGTTACCCTGTAAGG - Intergenic
1201552463 Y:15232788-15232810 TGTATTTCAGATACCTTGTCAGG + Intergenic