ID: 1122502752

View in Genome Browser
Species Human (GRCh38)
Location 14:102212291-102212313
Sequence GTCTGTCTGGTACCTTGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 114}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122502748_1122502752 0 Left 1122502748 14:102212268-102212290 CCAAGGAGTGTACTGTCCTTAAT 0: 1
1: 0
2: 1
3: 6
4: 84
Right 1122502752 14:102212291-102212313 GTCTGTCTGGTACCTTGTCTGGG 0: 1
1: 0
2: 1
3: 10
4: 114
1122502747_1122502752 10 Left 1122502747 14:102212258-102212280 CCAGTTTTTGCCAAGGAGTGTAC 0: 1
1: 0
2: 0
3: 5
4: 84
Right 1122502752 14:102212291-102212313 GTCTGTCTGGTACCTTGTCTGGG 0: 1
1: 0
2: 1
3: 10
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122502752 Original CRISPR GTCTGTCTGGTACCTTGTCT GGG Intronic
902531849 1:17095782-17095804 GTGTGTCTGGGAGCCTGTCTTGG + Intronic
906382935 1:45344468-45344490 GTCTGTCTCTTGCCTTTTCTTGG - Exonic
909743177 1:79058175-79058197 ATCTGTCCTCTACCTTGTCTGGG - Intergenic
917615515 1:176739830-176739852 GTCTGTCTTTTATGTTGTCTGGG + Intronic
919674243 1:200365958-200365980 GTCTGTCTGCTACCCTGTAGAGG - Intergenic
920353361 1:205352411-205352433 CTCTGTCTGGTCCTTTCTCTGGG - Intronic
921924610 1:220700993-220701015 TTCTGTCTGGTCCTTTGGCTGGG - Intergenic
922485874 1:225972648-225972670 CTCTTTCTGGTTCCTTCTCTGGG + Intergenic
924133301 1:240935245-240935267 GTCTGTCTACTACATTTTCTGGG + Intronic
1066053607 10:31660152-31660174 GTCTGTCTGGTTCCTGGTGGGGG - Intergenic
1068598543 10:58931303-58931325 AGCTGTCTGGTACTTTTTCTAGG + Intergenic
1074669925 10:115778774-115778796 GTTAGTCTGGTAGCTTGTGTAGG + Intronic
1075998319 10:126895681-126895703 GTCTTTCTGGTTCCATGGCTGGG - Intergenic
1079922384 11:26448863-26448885 GTCCGTCTGCTACCTTCTGTTGG + Intronic
1083116326 11:60463088-60463110 GACTGTGTGGTACCCTCTCTGGG + Exonic
1084436491 11:69144517-69144539 GCCTGTCTGGTACCTGGCCCTGG + Intergenic
1086481034 11:87239400-87239422 GTCTGTATGCTAGCTTGTGTTGG + Intronic
1087312804 11:96569563-96569585 GTGTGCCTGGTACTTTGCCTGGG - Intergenic
1088061624 11:105658892-105658914 GTCTGTCTGTCATCTTGACTTGG - Intronic
1091364716 11:135008029-135008051 GTCTGTGTGTTATCTTTTCTTGG + Intergenic
1091896172 12:4106875-4106897 GTCTGTCTGGCCTCTTGTCATGG - Intergenic
1101203132 12:102457551-102457573 GTCTGCCTGGGTCCTTGGCTAGG - Intronic
1104036417 12:125100482-125100504 GTCTGTCTGGTTCCCTGGCACGG + Intronic
1104594588 12:130112494-130112516 GGTTGTCTGGTGCCTGGTCTTGG - Intergenic
1114255080 14:20994764-20994786 GTCTGTCATGTTCCTTGTCTTGG + Intronic
1120012161 14:79428391-79428413 GTCTGCCTAGTACCTTCACTTGG + Intronic
1121506300 14:94480047-94480069 GTCTGTCTGTTAATTAGTCTAGG + Intergenic
1122502752 14:102212291-102212313 GTCTGTCTGGTACCTTGTCTGGG + Intronic
1124879537 15:33628488-33628510 GTCTGTCTCGGATCTTTTCTAGG - Exonic
1130825131 15:87536243-87536265 GTCAGTTTGGTACCTTGTTTGGG - Intergenic
1132410389 15:101573583-101573605 GTCTTTCTTGTCCCTTTTCTTGG - Intergenic
1133200857 16:4203734-4203756 GTGTGTCTGAAACCTTGTCTCGG + Intronic
1134164431 16:11918715-11918737 TTCTGCCTGGTACTTTTTCTAGG + Intergenic
1138331055 16:56215615-56215637 GTACGTTTGGTTCCTTGTCTAGG + Intronic
1138767128 16:59617896-59617918 GTTTGTCTGGTTCCTAGTCCTGG + Intergenic
1141319056 16:82989555-82989577 TTCTCTCTGGCACCTTCTCTAGG + Intronic
1142955714 17:3520110-3520132 ATCTGTCTGGTACCTTTTCTGGG - Intronic
1147881966 17:43660144-43660166 TTTTGTCTGGTTCCTTGTCCCGG - Intronic
1154075443 18:11195974-11195996 GTCTCTCTAGCACCTAGTCTGGG + Intergenic
1155566007 18:27135295-27135317 TTCTGTCTGATTCCTTGGCTGGG + Intronic
1160398310 18:78588427-78588449 GCCTGTTGGGCACCTTGTCTTGG + Intergenic
1164155660 19:22595675-22595697 GTGTGTCTGGAACATTGGCTAGG + Intergenic
1164423111 19:28114946-28114968 ATATGTCTGGTGCCTTGTCATGG + Intergenic
1165950877 19:39473371-39473393 GTCTGTCCTGTCCCTTCTCTAGG - Intronic
1166720852 19:44994917-44994939 TTCTGTCTGGTCCCCTGTCCCGG + Intergenic
1167427762 19:49438217-49438239 CTCTGTCTGCTTCCTTCTCTAGG - Intronic
927297268 2:21469113-21469135 GTGTGTCTGTTTCTTTGTCTAGG + Intergenic
931123652 2:59249628-59249650 TTCTGTCTGGTGCTTTGTCATGG + Intergenic
935650983 2:105381879-105381901 GTCTTTCTGGACCCTTTTCTGGG - Intronic
937680798 2:124642144-124642166 GGCTGTCTGGGAGCTTTTCTGGG + Intronic
938144316 2:128821244-128821266 GTCTGTCTGGGACTTTGGTTGGG - Intergenic
942899539 2:181097438-181097460 TTCTGTCTGTCACCTTGGCTAGG - Intergenic
946481332 2:220059667-220059689 GTCTGTCTGCTTCCTTCTCTTGG + Intergenic
947924773 2:233911680-233911702 GTCTGTCTGTCCCCCTGTCTGGG + Intergenic
948030561 2:234814239-234814261 CGCTGTCTGGTACCTGGCCTTGG + Intergenic
948862458 2:240759428-240759450 AGTTGTCTGGTACCTTGTCCTGG - Intronic
1169051100 20:2578530-2578552 TTCTGTTTGGTACATAGTCTGGG + Intronic
1174502955 20:50999129-50999151 AGCTGTCTGGTACCTGGCCTTGG + Intergenic
1178277643 21:31253456-31253478 GTCTGTCTGGGGCCTTGTGTAGG - Intronic
1179780427 21:43696636-43696658 GTCTGTCTGTGGACTTGTCTGGG - Intergenic
1181443839 22:22953250-22953272 ACTTGTCTGGTACCTGGTCTTGG + Intergenic
1181883246 22:25998343-25998365 CTCTGTCTGTCACCTTGGCTAGG + Intronic
1181946378 22:26520840-26520862 ATTTGTCTGGTACCTCGGCTGGG - Intergenic
1183722339 22:39569887-39569909 GTCTGTCCTGTCCCTTCTCTGGG + Intergenic
1183765041 22:39865361-39865383 GTATCTCTAGTACCTTCTCTAGG - Intronic
1184878223 22:47288869-47288891 GCCTGTCTGGTCTTTTGTCTGGG + Intergenic
1184926776 22:47647177-47647199 GTCTTTCTGTGACCTTATCTTGG + Intergenic
950260305 3:11538385-11538407 GTCTGTCTCGTCCCATGTCCTGG - Intronic
953476868 3:43212603-43212625 GTCAGTCTGGCACCTTGTTCAGG + Intergenic
954834267 3:53451662-53451684 GTCTGTCTGGGACCTTCACAAGG + Intergenic
955092074 3:55762350-55762372 TCCTGTCTGCTACCTTGCCTAGG + Intronic
956733493 3:72217917-72217939 GCCTGTCTGTTAGCTTATCTGGG + Intergenic
960594630 3:119397103-119397125 TTCTGTCTGGGACCTTGGCCTGG - Intronic
965559856 3:170050654-170050676 TTCTGTCTCTTGCCTTGTCTGGG + Intronic
967777484 3:193399529-193399551 GTCTGTCTGGTATTCTGTGTGGG + Intergenic
967999052 3:195189324-195189346 GTTTGTTTTGTAACTTGTCTGGG - Intronic
969483384 4:7458701-7458723 TCCTGGCTGGGACCTTGTCTCGG - Intronic
969570257 4:8004176-8004198 GTCTCTCTGCTGCCTGGTCTCGG - Intronic
975587368 4:75963742-75963764 GTCTGTCTGGCACCTGGTGGGGG - Intronic
976312610 4:83627451-83627473 ATCTGTATGGTGGCTTGTCTGGG + Intergenic
978243458 4:106544265-106544287 ATTTGTCTGGTCCCTGGTCTGGG - Intergenic
978378484 4:108101027-108101049 CTCTGTCTGGTTCCTTGCCTTGG + Intronic
981539253 4:145831930-145831952 TTCTGTTTGGTGGCTTGTCTGGG - Intronic
985053732 4:186018028-186018050 AACTGTCTGGTACCTGGTTTGGG + Intergenic
986380583 5:7181262-7181284 GCCTGTCTGGGACCTTTTCATGG + Intergenic
990786085 5:59421913-59421935 ATGTGTCTGGTGCTTTGTCTGGG - Intronic
991055492 5:62315313-62315335 TTCTGTCTGGTATGTAGTCTAGG + Intronic
991536652 5:67676161-67676183 TTCTGTCAGGTTCCCTGTCTAGG + Intergenic
994116625 5:96068315-96068337 GTCTGTCTTGGGTCTTGTCTAGG + Intergenic
1001716915 5:173824008-173824030 ATTTGTCGGGTACCTTGTATGGG - Intergenic
1002377659 5:178799718-178799740 GTCTCTCTGATACCTCGTCGTGG - Intergenic
1003554866 6:7130475-7130497 CTCTGCCTGGTGCCTGGTCTTGG + Intronic
1005190288 6:23213929-23213951 ATATGTCTGGTACCTGGGCTGGG + Intergenic
1005402455 6:25448750-25448772 GTATGCCTGGTACCTGGTTTTGG + Intronic
1007216454 6:40243824-40243846 GTCTGTCTGTTGTCTTTTCTGGG + Intergenic
1008548519 6:52605078-52605100 CTCGGTCTAGTGCCTTGTCTAGG - Intergenic
1012152387 6:95770493-95770515 GGTTGTCTGGTACCTGGTCCTGG - Intergenic
1017246337 6:152230533-152230555 GACTGTCAGGTAACTTGTCCAGG - Exonic
1018441327 6:163816129-163816151 TTCTTTCTGATGCCTTGTCTTGG + Intergenic
1019140088 6:169937524-169937546 GTCTGTCAGGCGCGTTGTCTGGG - Intergenic
1019377924 7:705644-705666 GTCTGTCCTGTACCCTGTCTAGG - Intronic
1020212497 7:6166932-6166954 GTCTGTCTAGACCCTGGTCTGGG + Intronic
1021984897 7:26088980-26089002 GCCTGTCTGGTTTCTTGACTAGG + Intergenic
1022513174 7:30955782-30955804 GTCTGTCTTGTTCCTGATCTCGG + Intronic
1023123078 7:36928899-36928921 GTCTTTCTGGTCCCTTGTTGTGG - Intronic
1026129935 7:67611976-67611998 GTGTGTCTGGTACTTTGGCTGGG + Intergenic
1026296397 7:69056666-69056688 GTCTGTAAGGTACCTTCTCATGG - Intergenic
1026542483 7:71292195-71292217 CTCAGCCTGGTACCTTTTCTAGG - Intronic
1031499341 7:122492893-122492915 CTCTGTCTGTTACCTGGGCTTGG + Intronic
1034553729 7:151836940-151836962 GTCTGGCAGGGACCTCGTCTCGG - Intronic
1035675999 8:1455870-1455892 GTCTGTCTTGTTCACTGTCTCGG + Intergenic
1038309630 8:26436336-26436358 GTCTGTGTGGTACTTTGTTGTGG + Intronic
1040355261 8:46611296-46611318 TTCTTTCTGGTATATTGTCTTGG - Intergenic
1040539786 8:48342217-48342239 GTCTGTCTGATACTTAATCTTGG + Intergenic
1041631588 8:60094428-60094450 GGTTGTCTGGTACCTAGCCTTGG - Intergenic
1042141728 8:65685989-65686011 GACTGACTGGAACCTTCTCTTGG - Intronic
1045263088 8:100594313-100594335 GTTTGTCTGTTTCCTTGTTTTGG - Intronic
1046505604 8:115134323-115134345 GTGTGTTTGGAACCTTTTCTGGG - Intergenic
1048034858 8:130667849-130667871 TTCTGCCTGGGACTTTGTCTTGG + Intergenic
1051651771 9:19333422-19333444 GCCTGTCTTGTACATTGTGTAGG + Intronic
1057301911 9:93891459-93891481 GGCTGTCTGGTACCTGCCCTGGG + Intergenic
1060066003 9:120501687-120501709 ATATGTCTGGTACCTTGTCGGGG - Intronic
1192230012 X:69257977-69257999 GACTGCCTGGTACCTTTTCCTGG + Intergenic
1196692013 X:118570120-118570142 ATCTGTCGAGTACCTTTTCTAGG + Intronic
1199655777 X:149994149-149994171 GTCTGTCTGGTGCTTTGGCAAGG + Intergenic
1200078060 X:153561651-153561673 GGCTGTCTGGTACCTGGTCCTGG + Intronic