ID: 1122502753

View in Genome Browser
Species Human (GRCh38)
Location 14:102212292-102212314
Sequence TCTGTCTGGTACCTTGTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 183}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122502748_1122502753 1 Left 1122502748 14:102212268-102212290 CCAAGGAGTGTACTGTCCTTAAT 0: 1
1: 0
2: 1
3: 6
4: 84
Right 1122502753 14:102212292-102212314 TCTGTCTGGTACCTTGTCTGGGG 0: 1
1: 0
2: 0
3: 17
4: 183
1122502747_1122502753 11 Left 1122502747 14:102212258-102212280 CCAGTTTTTGCCAAGGAGTGTAC 0: 1
1: 0
2: 0
3: 5
4: 84
Right 1122502753 14:102212292-102212314 TCTGTCTGGTACCTTGTCTGGGG 0: 1
1: 0
2: 0
3: 17
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122502753 Original CRISPR TCTGTCTGGTACCTTGTCTG GGG Intronic
905917832 1:41698206-41698228 TCTGGCTGGTACCTCCTCTATGG + Intronic
907017749 1:51033698-51033720 TCTATCTTGTCCCTTGTCTGTGG - Intergenic
907302245 1:53495666-53495688 TCTGCCTGGTTCCTTGTTGGTGG + Intergenic
908510291 1:64845660-64845682 CATGTCTGGAACCTGGTCTGTGG + Intronic
908590651 1:65629350-65629372 TCTGTGTTGTAATTTGTCTGTGG + Intronic
911165256 1:94719209-94719231 TCTGTGTGGTACCTTGGTTCTGG - Intergenic
915106991 1:153540911-153540933 TCTGTCTCTTCCCTTGGCTGAGG - Intronic
917618777 1:176773337-176773359 TCAGCCTGGTTCCTTGTATGTGG + Intronic
922054559 1:222028350-222028372 TATGTCTGGCACCTTGGCAGGGG + Intergenic
922485875 1:225972649-225972671 TCTTTCTGGTTCCTTCTCTGGGG + Intergenic
923220840 1:231891608-231891630 GTTGTTTGGTACCTGGTCTGGGG + Intronic
923731474 1:236555230-236555252 TCTTACTGGTACCTTGTATAAGG + Intronic
923746599 1:236706597-236706619 TCTTTCTCTTACCTTGTCTTTGG + Intronic
924747767 1:246853348-246853370 TCTGTTTGCTTCCTTGTGTGTGG - Intronic
1063473214 10:6305887-6305909 TCTGCCTGGAACCTGGTTTGAGG + Intergenic
1064465396 10:15574753-15574775 TCTGTCTGGTACCTTCTAGTTGG + Intronic
1064524005 10:16233745-16233767 TCTGTATGCTCCCTTGTCTTTGG - Intergenic
1065353714 10:24818754-24818776 TCTCTCTGTTCCCCTGTCTGTGG + Intergenic
1068082030 10:52330974-52330996 TATTTCTGCTATCTTGTCTGAGG - Intergenic
1068193356 10:53683582-53683604 TGTGTCTATTACCTTGACTGTGG - Intergenic
1068598544 10:58931304-58931326 GCTGTCTGGTACTTTTTCTAGGG + Intergenic
1071583514 10:86796271-86796293 TGTGACTGGTCCCTTTTCTGAGG + Intronic
1072336736 10:94403814-94403836 TCTTTCTGTTGCCTTGTCCGCGG + Intronic
1072705559 10:97678427-97678449 TCTCTCTGCTGCCTTCTCTGGGG - Intronic
1073454478 10:103628341-103628363 TCTGTCTCCTACCCTTTCTGGGG + Intronic
1074319226 10:112385761-112385783 TGTCTCTGGTATCTTTTCTGCGG + Intronic
1075165888 10:120067864-120067886 TATGTCTATTACCTTGACTGTGG - Intergenic
1076987179 11:246565-246587 TGTGCCTGGTCCCTTGTGTGTGG + Intronic
1077835441 11:5923142-5923164 TCTGCCTGGTGCCCTCTCTGTGG - Intronic
1078321448 11:10338755-10338777 TCTCTCTGTTACTTTTTCTGAGG - Intronic
1079578588 11:22033419-22033441 GCTGTCTGTTACCTTGAGTGAGG - Intergenic
1081580657 11:44349374-44349396 CCTGGCTGGTACCTGGTCTCTGG + Intergenic
1083051150 11:59777945-59777967 ACTGTCTGGTGCCTTTACTGGGG + Intronic
1083116327 11:60463089-60463111 ACTGTGTGGTACCCTCTCTGGGG + Exonic
1083244338 11:61414519-61414541 TCTGTCTTTAACCTTCTCTGTGG + Intronic
1083996548 11:66275925-66275947 CCCGTCTGCTACCTTGGCTGTGG - Exonic
1084836830 11:71807997-71808019 TCTGTCTCCTCACTTGTCTGGGG - Intergenic
1085535152 11:77213083-77213105 TCGTTCTGGGACCGTGTCTGTGG - Intronic
1090171277 11:124607224-124607246 TCTGTCTTGTTCCTTCTCTCAGG - Intergenic
1091990653 12:4953035-4953057 TGTGATTGGTACCTTGGCTGAGG + Intergenic
1093250726 12:16801218-16801240 ACTCTCTGGTTCCATGTCTGGGG + Intergenic
1093983818 12:25505154-25505176 TCTGTCTGTTTCCATGTCAGTGG + Intronic
1100343789 12:93707444-93707466 GATGTCTGGTGCCTTGACTGGGG + Intronic
1100387243 12:94114867-94114889 TCAGGCTGGTGCTTTGTCTGTGG - Intergenic
1103072593 12:117957209-117957231 TCTGTCTGTTCCTGTGTCTGCGG + Intronic
1103706159 12:122874128-122874150 GCTGTGTGCTACCTTGACTGAGG - Intronic
1104796551 12:131524004-131524026 TCTCTGTGGTACCTTTTATGAGG - Intergenic
1105748838 13:23402703-23402725 TCTGCCTGGTACCTTGCTTATGG + Intronic
1109616016 13:64834824-64834846 ACTGTCTGGTACCTTGATTTTGG + Intergenic
1109946000 13:69433241-69433263 TCTTCCTTGTACATTGTCTGTGG - Intergenic
1112285952 13:98104608-98104630 GTTGTCTGGTACCTGGCCTGGGG + Intergenic
1112330904 13:98476330-98476352 TCTGTCTGGCTCCGTTTCTGTGG - Intronic
1112428736 13:99330538-99330560 TATTTCTGGTAGCTTTTCTGTGG + Intronic
1113154665 13:107306194-107306216 TCTGTCTGGTGGCTTTTCTTTGG - Intronic
1114158191 14:20131263-20131285 TCTGTCTTTTACATTTTCTGAGG + Intergenic
1114393643 14:22337172-22337194 TCTGTCTGGTACTTCCTCTAAGG + Intergenic
1114945957 14:27680453-27680475 TCTTTAAGCTACCTTGTCTGCGG + Intergenic
1115975062 14:38988317-38988339 TCTGTGTGGTACCATCGCTGGGG - Intergenic
1116502630 14:45638939-45638961 TCTATCTGGTACCTTTTTTTTGG + Intergenic
1116928281 14:50664175-50664197 TTTGTCTAGTACCTTATTTGTGG - Intronic
1117270150 14:54135293-54135315 TCTGGCTGGGACCTTAACTGGGG - Intergenic
1118013709 14:61636938-61636960 TCGGTCTAGTACCTTGTATGAGG - Intronic
1121853913 14:97248998-97249020 GCTGTCTGTCATCTTGTCTGAGG - Intergenic
1122502753 14:102212292-102212314 TCTGTCTGGTACCTTGTCTGGGG + Intronic
1122840481 14:104460082-104460104 TCTAACTTGAACCTTGTCTGCGG - Intergenic
1123843093 15:24269095-24269117 TTTTTATGGTTCCTTGTCTGAGG - Intergenic
1123858136 15:24435173-24435195 TTTTTATGGTTCCTTGTCTGAGG - Intergenic
1124169569 15:27360614-27360636 TCTGTCTGGAACCTTGCCCTTGG + Intronic
1131867909 15:96731493-96731515 TCTGCCTGGGTCCCTGTCTGTGG + Intergenic
1134098415 16:11434898-11434920 TCCGTCTGGTCTCATGTCTGAGG - Intronic
1134164432 16:11918716-11918738 TCTGCCTGGTACTTTTTCTAGGG + Intergenic
1134831343 16:17326097-17326119 TATGTCTGTTACCTTGATTGTGG - Intronic
1139409313 16:66746330-66746352 TCTGGCTTGTACCTAGTTTGTGG - Intronic
1139576424 16:67845292-67845314 TCTGCCTGGGGACTTGTCTGTGG + Intronic
1140357316 16:74317623-74317645 TCTGTCTGTTACTTTATCTGTGG + Intergenic
1140627830 16:76815655-76815677 GCAGTCTGGTATTTTGTCTGGGG - Intergenic
1143996698 17:11012585-11012607 TCTTTCTGGTGGCTTGACTGAGG + Intergenic
1144669040 17:17121416-17121438 GCAGTCTGCTTCCTTGTCTGCGG + Intronic
1146908038 17:36630416-36630438 TTTGTCTCGTCCGTTGTCTGGGG + Intergenic
1155635020 18:27942418-27942440 TCTCTCTGTGTCCTTGTCTGTGG - Intergenic
1156747702 18:40412354-40412376 TCTGTCTAGTCCCTTGTGTGTGG + Intergenic
1157730282 18:49998014-49998036 TCTATCTGGGACCTTGTATCAGG - Intronic
1157909263 18:51599717-51599739 TCTCTCTGCCACCTTGACTGTGG - Intergenic
1158125321 18:54094245-54094267 GCTGACTGGTCCCTTGTCTTTGG - Intergenic
1159629064 18:70728162-70728184 GCTGTCTGGTACCGGGCCTGGGG - Intergenic
1161121180 19:2527683-2527705 TCTGGCTGGATCCTTTTCTGGGG + Intronic
1164234027 19:23316531-23316553 TCTGCCTGGTCCCTTGTGTCAGG + Intronic
1164294792 19:23900411-23900433 TCTGTCTGGTATGTCCTCTGAGG + Intergenic
1164325462 19:24187525-24187547 TCTGCCTGGTCCCTTGTGTCAGG - Intergenic
1166256643 19:41610787-41610809 TCTGCCTGGTACCAGGTGTGTGG - Intronic
925408681 2:3626291-3626313 ACTGTCTGGTTCCACGTCTGTGG - Intronic
928393003 2:30923606-30923628 TCTGTCTGCCACCCTGTCTCTGG - Intronic
929344106 2:40859751-40859773 GCTGTCTGTTACCTTGTCCCTGG - Intergenic
932049087 2:68381118-68381140 TCTCTCTGGTACCCAGTATGAGG - Intronic
934658819 2:96132374-96132396 TCTGTCTGGTACCTGGTACCTGG - Intronic
934975721 2:98800776-98800798 TGTATCTGGTACATAGTCTGTGG - Intronic
936924675 2:117724341-117724363 TCTGTTTGGTGCCTTTTGTGAGG - Intergenic
937654911 2:124363757-124363779 TATGTCTATTACCTTGACTGTGG + Intronic
937680799 2:124642145-124642167 GCTGTCTGGGAGCTTTTCTGGGG + Intronic
939166499 2:138646614-138646636 TCTGTGTCTTCCCTTGTCTGAGG + Intergenic
939514849 2:143153616-143153638 TATGTCTGTTACCTTGATTGTGG - Intronic
939639633 2:144623864-144623886 TCTGTATGCTACATTGTTTGAGG + Intergenic
940018381 2:149130723-149130745 TCTTTCTTGTACCTGGTTTGTGG + Intronic
941180910 2:162258309-162258331 TATGTCTGTTTCCTTCTCTGTGG - Intergenic
943308132 2:186292572-186292594 TGTGTCTATTACCTTGACTGTGG + Intergenic
944204250 2:197140797-197140819 TCTGTCTATTACCTTGATTGTGG + Intronic
944493224 2:200279440-200279462 TCCATCTGGTACCTATTCTGTGG + Intergenic
945593032 2:211757692-211757714 TCTGTCTGATATCCTGTCTAAGG - Intronic
946481333 2:220059668-220059690 TCTGTCTGCTTCCTTCTCTTGGG + Intergenic
946732453 2:222722650-222722672 TCAGTCTGATACCCTATCTGGGG + Intergenic
947887420 2:233584742-233584764 TCGGTCTGGTGCCTTGTTTCAGG - Intergenic
948118927 2:235514530-235514552 TCTGTCTGGGGCCCTGCCTGGGG + Intronic
948443504 2:238013577-238013599 TCTGTCTGGTAACAAATCTGTGG - Intronic
948862457 2:240759427-240759449 GTTGTCTGGTACCTTGTCCTGGG - Intronic
1168860953 20:1045818-1045840 TCTGTCTGGTACCAGAGCTGAGG + Intergenic
1169840468 20:9930107-9930129 TCTCTCTGTTACTTTTTCTGTGG + Intergenic
1170317453 20:15058063-15058085 TCTTTCTTTCACCTTGTCTGAGG + Intronic
1172826875 20:37796336-37796358 TCTGTCTCCTCCCTTCTCTGAGG + Intronic
1173115525 20:40238891-40238913 ACTGTCTGATGCCTTGTCTGAGG + Intergenic
1173248804 20:41353843-41353865 TCTGGCTGGTACAGGGTCTGAGG + Intronic
1174418090 20:50380739-50380761 TAAGTATGGTACCTTCTCTGGGG - Intergenic
1176720760 21:10390682-10390704 TCTGTCTGCTACCTAGTATTAGG - Intergenic
1177428990 21:20964903-20964925 TATGTCTGTTACCTTGACTGTGG - Intergenic
1180148273 21:45934046-45934068 TCTGTCTGGAACCTAGGCTGAGG + Intronic
1181883247 22:25998344-25998366 TCTGTCTGTCACCTTGGCTAGGG + Intronic
1182465979 22:30516469-30516491 ATTGTTTGGTACCTGGTCTGTGG + Intergenic
1183001136 22:34860130-34860152 TCTGTCTTGTTCATTGTCTCAGG + Intergenic
1183236271 22:36620798-36620820 TCTGTCTTGTATCTGGCCTGAGG + Intronic
953492406 3:43362941-43362963 TCTGTCAGGTCCCTTGGATGGGG + Intronic
954419531 3:50411336-50411358 TCTTTCTGCTACCATGTCCGTGG + Intronic
956497879 3:69848411-69848433 TCTGTCTATTACCATGGCTGAGG + Intronic
956786808 3:72649622-72649644 TCTGGATGGTTCCTTGTGTGGGG - Intergenic
956890612 3:73609758-73609780 TTTGTCTTCTACCTTTTCTGGGG + Intronic
960454095 3:117849091-117849113 TCTGTCTTGTGCCTTGCCTTTGG - Intergenic
966283329 3:178261991-178262013 TCTGTTTGTTTCCTTGTTTGGGG + Intergenic
967011918 3:185443187-185443209 TGTGTCTGGTGCCTTTTCTGTGG - Intronic
967401733 3:189070332-189070354 ACTGTTCAGTACCTTGTCTGTGG + Intronic
967425135 3:189318148-189318170 TCTGTCTGGTATCTGGTGGGAGG + Intronic
970692936 4:18640966-18640988 TCGTGCTGGTACCTTGTCTTTGG + Intergenic
973600539 4:52538307-52538329 TATGTCTGGCACCTGGTCTGTGG + Intergenic
974036790 4:56824449-56824471 TCTGGCTGGAATCCTGTCTGAGG + Intergenic
976312611 4:83627452-83627474 TCTGTATGGTGGCTTGTCTGGGG + Intergenic
977794247 4:101143430-101143452 TCTTTCAGGTAGCTTGACTGAGG - Intronic
978378485 4:108101028-108101050 TCTGTCTGGTTCCTTGCCTTGGG + Intronic
979733192 4:124049702-124049724 TATGTTTAGTACCTTGGCTGTGG - Intergenic
983136490 4:164089484-164089506 TATGTCTATTACCTTGACTGAGG + Intronic
985053733 4:186018029-186018051 ACTGTCTGGTACCTGGTTTGGGG + Intergenic
988087324 5:26488397-26488419 TCTGTCTGGTGCCCTGTCTCTGG + Intergenic
989554693 5:42780240-42780262 TCAGTCTGGTTCCTCATCTGAGG + Intronic
991131836 5:63131679-63131701 TATGTCTGGCACCTGGGCTGGGG + Intergenic
993360121 5:86964607-86964629 TATGTCTGTTACCTTGGTTGTGG + Intergenic
993409974 5:87561527-87561549 TCTGTCTAGTACCTACTTTGTGG - Intergenic
1001716914 5:173824007-173824029 TTTGTCGGGTACCTTGTATGGGG - Intergenic
1003554867 6:7130476-7130498 TCTGCCTGGTGCCTGGTCTTGGG + Intronic
1004640778 6:17513583-17513605 TCTGTCGGGTCCCCTCTCTGTGG + Intronic
1005148204 6:22716987-22717009 TCTGTCTGGATCCTTATCTCAGG + Intergenic
1005763656 6:28989730-28989752 CCAGTCAGGTACCTTCTCTGTGG + Intergenic
1007498979 6:42280979-42281001 ACTGTCTGGTGCTTTGTATGTGG + Intronic
1009666583 6:66689175-66689197 TCTCTCTGGTATCCTGTCTTTGG - Intergenic
1011991227 6:93520322-93520344 TCTGTCAATTACCTTGCCTGTGG + Intergenic
1012257957 6:97055764-97055786 TCAGTCTGTTACCTCGGCTGGGG - Intronic
1018188947 6:161291707-161291729 CCTGTGTGGAACCTTGACTGGGG - Intergenic
1018573294 6:165233180-165233202 TGTGTCTGCTGCCCTGTCTGTGG - Intergenic
1021923809 7:25515058-25515080 TCTGTGTGGTAGCTTGAGTGTGG + Intergenic
1023572089 7:41582747-41582769 TATGTCTGGCACCTCATCTGGGG - Intergenic
1027696113 7:81412449-81412471 TATGTCTGTTACCTTGATTGTGG + Intergenic
1028682168 7:93548122-93548144 TCTGTCTTACAACTTGTCTGAGG + Intronic
1032317389 7:130851729-130851751 TATGTCTGTTAACTTGACTGTGG - Intergenic
1032826392 7:135573061-135573083 TAAGTCAGGTAACTTGTCTGTGG - Intronic
1034550194 7:151815471-151815493 GCTGTCTGGTACCTGCCCTGGGG - Intronic
1034675860 7:152892038-152892060 TGTTTCTGGCACCCTGTCTGTGG + Intergenic
1035623571 8:1053422-1053444 TCCTTCTGGTTCCTTCTCTGTGG - Intergenic
1035694106 8:1581541-1581563 TCTTTCTGGTAGTTTGACTGTGG - Intronic
1038370486 8:26984572-26984594 TCTGTTTAGTACCTTGACTATGG + Intergenic
1038577236 8:28715921-28715943 TTTATTTGGTGCCTTGTCTGGGG + Exonic
1038663956 8:29521319-29521341 TGTCTCTGGTACCTTGTATCTGG + Intergenic
1038698114 8:29824429-29824451 TGTGCCTGGAACCTTCTCTGTGG - Intergenic
1040355260 8:46611295-46611317 TCTTTCTGGTATATTGTCTTGGG - Intergenic
1041344702 8:56884778-56884800 TCTTTGTGGTTCCTTTTCTGTGG - Intergenic
1042703037 8:71637573-71637595 TCTCTCTTGTACCCTCTCTGGGG + Intergenic
1046049537 8:109005963-109005985 TATGTCTGTTCCCTTGACTGTGG - Intergenic
1046434979 8:114175668-114175690 TTTGTCTAGTAGCTTCTCTGTGG - Intergenic
1046447512 8:114342057-114342079 TCTGCCTGGTACCTTGGCACTGG - Intergenic
1046450038 8:114377045-114377067 TTTGTTTGATACCTAGTCTGTGG - Intergenic
1046970409 8:120216739-120216761 TGTATCTGGTGCCTGGTCTGGGG + Intronic
1048034859 8:130667850-130667872 TCTGCCTGGGACTTTGTCTTGGG + Intergenic
1048078651 8:131101073-131101095 TTTGTCTGTTACCTTGACTGTGG - Intergenic
1049973174 9:839022-839044 CCTGTCTGGTACCTCTTCTGTGG + Intergenic
1050242334 9:3650073-3650095 TCTGTCTGTTACCAAGTCTCTGG - Intergenic
1056741757 9:89262345-89262367 GTTGGCTGGTAGCTTGTCTGGGG - Intergenic
1056953478 9:91064377-91064399 TATGTTTGGTATCTTGACTGTGG - Intergenic
1056992231 9:91423232-91423254 TCTTTCTCGTTCCTTCTCTGGGG - Intronic
1057301912 9:93891460-93891482 GCTGTCTGGTACCTGCCCTGGGG + Intergenic
1057379964 9:94558887-94558909 TTTGTCTTGCACCTTGTCTAAGG - Exonic
1062652270 9:137584071-137584093 TCCGTCTGGATCCTGGTCTGTGG - Intronic
1186649276 X:11541336-11541358 AGTGTCTGGTACCTGGCCTGGGG + Intronic
1186998557 X:15150613-15150635 TATGTCTAGTATCTTGACTGTGG - Intergenic
1187817154 X:23244687-23244709 TCTGACTGGTATCTTTTATGGGG - Intergenic
1192333511 X:70199371-70199393 CCTGTCTCTTACCTTGACTGTGG - Exonic
1198416867 X:136429160-136429182 TATGTCTATTACCTTGACTGTGG - Intergenic
1200078061 X:153561652-153561674 GCTGTCTGGTACCTGGTCCTGGG + Intronic