ID: 1122505570

View in Genome Browser
Species Human (GRCh38)
Location 14:102229792-102229814
Sequence TTGGGGTGTCTGGGACCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 282}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122505570_1122505590 26 Left 1122505570 14:102229792-102229814 CCACCAGGTCCCAGACACCCCAA 0: 1
1: 0
2: 1
3: 27
4: 282
Right 1122505590 14:102229841-102229863 CGGGGGAGGCCAAACCTTCAGGG 0: 1
1: 0
2: 0
3: 4
4: 284
1122505570_1122505592 28 Left 1122505570 14:102229792-102229814 CCACCAGGTCCCAGACACCCCAA 0: 1
1: 0
2: 1
3: 27
4: 282
Right 1122505592 14:102229843-102229865 GGGGAGGCCAAACCTTCAGGGGG 0: 1
1: 0
2: 0
3: 17
4: 122
1122505570_1122505581 7 Left 1122505570 14:102229792-102229814 CCACCAGGTCCCAGACACCCCAA 0: 1
1: 0
2: 1
3: 27
4: 282
Right 1122505581 14:102229822-102229844 GCTGCCCACTAGAGTCCCACGGG 0: 1
1: 0
2: 0
3: 9
4: 110
1122505570_1122505591 27 Left 1122505570 14:102229792-102229814 CCACCAGGTCCCAGACACCCCAA 0: 1
1: 0
2: 1
3: 27
4: 282
Right 1122505591 14:102229842-102229864 GGGGGAGGCCAAACCTTCAGGGG 0: 1
1: 0
2: 0
3: 14
4: 145
1122505570_1122505589 25 Left 1122505570 14:102229792-102229814 CCACCAGGTCCCAGACACCCCAA 0: 1
1: 0
2: 1
3: 27
4: 282
Right 1122505589 14:102229840-102229862 ACGGGGGAGGCCAAACCTTCAGG 0: 1
1: 0
2: 0
3: 9
4: 59
1122505570_1122505582 8 Left 1122505570 14:102229792-102229814 CCACCAGGTCCCAGACACCCCAA 0: 1
1: 0
2: 1
3: 27
4: 282
Right 1122505582 14:102229823-102229845 CTGCCCACTAGAGTCCCACGGGG 0: 1
1: 0
2: 0
3: 4
4: 98
1122505570_1122505580 6 Left 1122505570 14:102229792-102229814 CCACCAGGTCCCAGACACCCCAA 0: 1
1: 0
2: 1
3: 27
4: 282
Right 1122505580 14:102229821-102229843 GGCTGCCCACTAGAGTCCCACGG 0: 1
1: 1
2: 2
3: 26
4: 247
1122505570_1122505586 12 Left 1122505570 14:102229792-102229814 CCACCAGGTCCCAGACACCCCAA 0: 1
1: 0
2: 1
3: 27
4: 282
Right 1122505586 14:102229827-102229849 CCACTAGAGTCCCACGGGGGAGG 0: 1
1: 0
2: 0
3: 2
4: 67
1122505570_1122505583 9 Left 1122505570 14:102229792-102229814 CCACCAGGTCCCAGACACCCCAA 0: 1
1: 0
2: 1
3: 27
4: 282
Right 1122505583 14:102229824-102229846 TGCCCACTAGAGTCCCACGGGGG 0: 1
1: 0
2: 0
3: 1
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122505570 Original CRISPR TTGGGGTGTCTGGGACCTGG TGG (reversed) Intronic
900301569 1:1980591-1980613 TGGGGGTTCCTGGGACCTGCTGG + Intronic
901055352 1:6446576-6446598 TAGGGATGTCTGGGGCCTGCAGG + Intronic
901489675 1:9590168-9590190 TTGGGTTGTCAGGGACCTCTGGG - Intronic
901817722 1:11804492-11804514 TTGGCCTGTCTGTGCCCTGGTGG - Intronic
902479012 1:16702013-16702035 TAGGGATGTCTGGGGCCTGCAGG - Intergenic
902704818 1:18197298-18197320 GTGGGGTGTCTGGACCCAGGAGG + Intronic
903273770 1:22208254-22208276 GTGGGGTGTCTGGGAGCCCGTGG - Intergenic
903464191 1:23540659-23540681 TGGGGGTGGCTGGGCCGTGGTGG - Intergenic
903651940 1:24927822-24927844 TCAGTGTGCCTGGGACCTGGGGG - Intronic
903778140 1:25806179-25806201 TGGGTGTGTCTGGGCCCAGGGGG + Intronic
904976688 1:34461964-34461986 TGGTGGTGTCAGGGACCTTGGGG + Intergenic
905147893 1:35902227-35902249 TCAGGGTGTCTGGGACATGCGGG + Exonic
905173413 1:36122497-36122519 TTGAGATGACTGGGAGCTGGAGG - Intronic
906646447 1:47478682-47478704 TGATGGTGTCTGGGACCTGGAGG - Intergenic
906718467 1:47988005-47988027 CAGGGGTGTCTGGGGCCTCGGGG + Intronic
910436776 1:87213302-87213324 GTGGAGTGACTGGGAGCTGGTGG + Intergenic
911157153 1:94647956-94647978 GTGGGGAGTTTGTGACCTGGAGG - Intergenic
913482493 1:119302094-119302116 TTGAGGTGTCTAGGACTTGGTGG + Intergenic
915342097 1:155182170-155182192 ATGGGGTGTGGGGGTCCTGGTGG + Intronic
916296726 1:163228091-163228113 TTCTGGGGTCTGGGATCTGGAGG + Intronic
916790954 1:168124744-168124766 TAGAGGTGTCTGGGTCATGGGGG + Intronic
917198725 1:172493638-172493660 TTAGAGTGTTTGGGACATGGGGG + Intergenic
918056858 1:181029367-181029389 TTGTGGTGGGAGGGACCTGGTGG + Intergenic
919176235 1:194021953-194021975 GGGGGGTGTTTGGGACATGGGGG + Intergenic
922722337 1:227905367-227905389 TGGGGGCATCTGGGACCTTGTGG - Intergenic
923463809 1:234231203-234231225 TTGGAGAGCCTCGGACCTGGAGG + Intronic
923474646 1:234321184-234321206 TGGGGGAGTCTGGGCCATGGTGG - Intronic
924706598 1:246507387-246507409 GTGGAGTGTGTGGGACCTGAAGG + Intergenic
1062895854 10:1102675-1102697 TGGGGGTGTCTGGCTCATGGGGG - Intronic
1062923048 10:1294340-1294362 TTGTGATGCCTGGGACCTGGCGG + Intronic
1063893947 10:10659621-10659643 TTGAAGGGTCTGGGAACTGGAGG - Intergenic
1064184299 10:13147378-13147400 TGGGAGTGTCTGGGTCATGGGGG - Intergenic
1064913907 10:20435159-20435181 TGGGAGTGACTTGGACCTGGTGG - Intergenic
1065002399 10:21348713-21348735 AGGAGGTGTCTGGGTCCTGGGGG - Intergenic
1067160278 10:43819569-43819591 TGGGGCTGTCTGGGGCCAGGGGG + Intergenic
1069807302 10:71133982-71134004 GTGGGGTGCCTGGGGCTTGGAGG - Intergenic
1069961231 10:72080607-72080629 TGGGGGTGGCTGGGAAGTGGGGG + Intronic
1070777136 10:79116274-79116296 TGGGGGTGTCTCGACCCTGGGGG + Intronic
1071346524 10:84699119-84699141 TGGGGGAGTATGGGAACTGGTGG + Intergenic
1072717777 10:97762985-97763007 GTGGGGTTGCTGGGAGCTGGGGG - Intergenic
1073268113 10:102240706-102240728 TTGGGGTGTCTGGGCCCAGAAGG - Intronic
1074302241 10:112242947-112242969 TTGGGGTGCATGGGACCTAGTGG - Intergenic
1074389290 10:113043657-113043679 TGGGGGTGTCTTGGAACTTGTGG - Intronic
1075337288 10:121617603-121617625 TTGGGGTGTTGGGGGCATGGTGG - Intergenic
1076525909 10:131112332-131112354 TTGGGGCATCTGGGCCCAGGAGG - Intronic
1076704070 10:132291727-132291749 ATGGGGTCTCTGGGACCTGAAGG - Intronic
1076852465 10:133099784-133099806 TGGCTGTGTCTGGGCCCTGGAGG - Intronic
1077375003 11:2201626-2201648 TTGGGGTTTCAGAGAACTGGAGG - Intergenic
1077429271 11:2507989-2508011 TGTGGGAGTCTGGGTCCTGGTGG + Intronic
1077429408 11:2508587-2508609 TCTGGGAGTCTGGGTCCTGGTGG - Intronic
1078510357 11:11980163-11980185 ATGTGGTGTCAGGGTCCTGGGGG - Intronic
1079385893 11:19979373-19979395 CTGGGCTGCATGGGACCTGGGGG - Intronic
1081781338 11:45715273-45715295 TTGGGGAGTCTGGGACTGGAGGG - Intergenic
1081966504 11:47173381-47173403 GTGGGGTGTCTGGGAGAGGGTGG - Intronic
1083770220 11:64863081-64863103 TTGGGTGGCCTGGGACCTGTGGG - Intronic
1084705571 11:70814392-70814414 TGGGGGTGGCTGGGCCCTGCTGG - Intronic
1084828268 11:71747850-71747872 TTGGGGTTTTTAGGACCTAGAGG - Intergenic
1085185293 11:74570824-74570846 TTGGGGTGTCAGGCACATGGAGG + Intronic
1085440564 11:76558876-76558898 TTGGGGTGGTAAGGACCTGGGGG + Intergenic
1086850227 11:91799706-91799728 TTGTTGTGTGAGGGACCTGGTGG - Intergenic
1087696375 11:101381296-101381318 TTGGGGAGGCTGGGGGCTGGAGG - Intergenic
1088893435 11:114061131-114061153 TGGGGGTCGCTGGGAACTGGGGG + Intronic
1089340932 11:117756929-117756951 TTGGGGTTGCTTTGACCTGGAGG + Intronic
1092527523 12:9318311-9318333 TTGGGGATTCTTGGTCCTGGCGG - Intergenic
1092539737 12:9413444-9413466 TTGGGGATTCTTGGTCCTGGAGG + Intergenic
1093110404 12:15145158-15145180 TGGGGTTGTTTGGGAACTGGGGG - Intronic
1094552906 12:31469688-31469710 GTGAGGTGTTTGGGTCCTGGGGG + Intronic
1094838956 12:34334984-34335006 TTGGAGTGGCTGGGCCCTTGGGG + Intergenic
1094843382 12:34351193-34351215 TTGGGGTCTCAGGGACCCTGGGG - Intergenic
1096680490 12:53252334-53252356 GTGGGGTGCCAGTGACCTGGAGG + Intronic
1101919051 12:108918016-108918038 GAGGGGTGTCTGGGAGCTGCTGG - Intronic
1102551511 12:113695285-113695307 TTGGGAGGTCTGGGGGCTGGAGG - Intergenic
1103918163 12:124386468-124386490 TTAGGGAGTTTGGGCCCTGGAGG - Intronic
1104640085 12:130461613-130461635 GGGAGGTGTCTGGGTCCTGGGGG + Intronic
1104728527 12:131092624-131092646 TTGGGGTGGCTCTGACCTGGGGG + Intronic
1104895882 12:132163400-132163422 TTGGAGTGGCTCGGACCTGCAGG - Intergenic
1104981208 12:132573818-132573840 TGGGGCTGTCTCGGCCCTGGTGG + Intronic
1106113281 13:26795553-26795575 TTGGGGCCTCTGGGAGGTGGTGG - Intergenic
1107671556 13:42751307-42751329 TTGGGTTGTCTGGGAATTTGAGG - Intergenic
1107872634 13:44761265-44761287 GTGGGGTGACGGGTACCTGGGGG - Intergenic
1113121180 13:106925010-106925032 GTGGGGTGTCAGGGTCCTGTAGG + Intergenic
1113500602 13:110770851-110770873 TTGGGGTGTGTGGAGGCTGGAGG + Intergenic
1114865006 14:26579486-26579508 TTTGCGTGACTGTGACCTGGAGG - Intronic
1115457732 14:33624067-33624089 TAGGGGTGTCAGGGAGCTTGGGG - Intronic
1118818592 14:69329866-69329888 TAGGGGTGTTTGGGTCATGGGGG - Intronic
1120684621 14:87523947-87523969 TTGTGCTGTTTGGTACCTGGGGG - Intergenic
1120827728 14:88970422-88970444 TGCAGGTGCCTGGGACCTGGAGG - Intergenic
1120889385 14:89478051-89478073 TGGAGGTGTCTGGGTCATGGGGG + Intronic
1120917127 14:89720084-89720106 TTGTGGTGGGAGGGACCTGGTGG + Intergenic
1120969070 14:90192413-90192435 GGGGGGTGTCTGGGTCATGGGGG - Intergenic
1121733469 14:96202374-96202396 TTGGGCTGACTCGAACCTGGAGG + Intergenic
1122505570 14:102229792-102229814 TTGGGGTGTCTGGGACCTGGTGG - Intronic
1122569413 14:102684370-102684392 TTGGGGTGCATGAGACCTAGGGG + Intronic
1122850181 14:104523829-104523851 GGGAGGTGTCTGGGTCCTGGGGG - Intronic
1122896411 14:104759764-104759786 GTGGGGTCTCTAGGAGCTGGCGG - Intronic
1123671684 15:22664996-22665018 TTGGGTGGCCTGGGACCCGGTGG + Intergenic
1128030835 15:64478619-64478641 TTTGGGAGTCTGGGAAGTGGGGG - Intronic
1128906098 15:71468977-71468999 TTTGCGTGTCTGAAACCTGGTGG + Intronic
1130899612 15:88197439-88197461 TTGGGATGTCTTGGGCCTGTAGG - Intronic
1131080243 15:89528674-89528696 GTGAGGGGTCTGGGGCCTGGAGG - Intergenic
1131098591 15:89671266-89671288 GTGGGGTTTCTGGGACCAGCAGG - Intronic
1132630256 16:913882-913904 TCGGGGTGTCGGGGGCCTGCAGG - Intronic
1132909218 16:2299719-2299741 TGAGGGTGTCTGGGACGTGTTGG - Intronic
1133007815 16:2894519-2894541 TGGGGATGCCGGGGACCTGGGGG - Intronic
1137054104 16:35735211-35735233 CTGGGGAGACTGGGGCCTGGAGG + Intergenic
1137056668 16:35749384-35749406 ATGGGGAGACTGGGTCCTGGAGG + Intergenic
1137583021 16:49645728-49645750 TTGTGGTGGGAGGGACCTGGTGG + Intronic
1139180003 16:64735906-64735928 TTGTGGTGTCTGGACCCTTGGGG - Intergenic
1139467317 16:67160904-67160926 CTTGGGTCTCTGGGACCTGACGG - Intronic
1139484524 16:67248388-67248410 TTAGGGTTTCTGGGACGTTGGGG + Intronic
1139581421 16:67876141-67876163 TTGGGGTGTCTGCTAGCTGAAGG + Intronic
1139653840 16:68375804-68375826 TTGAGGTGACTGGCAGCTGGTGG + Intronic
1140263121 16:73397797-73397819 TTGGGGGGTCTTGGAAATGGGGG + Intergenic
1141419051 16:83899742-83899764 GCGGGGTGTGTGGGACTTGGAGG - Intronic
1142210068 16:88804562-88804584 CTGGGATGTCTGGGGCCTCGGGG - Exonic
1143495181 17:7308326-7308348 TTCCGGTGGCCGGGACCTGGGGG - Intronic
1144185913 17:12794812-12794834 GTGGGGAGCCTGGGAACTGGAGG + Intronic
1144698659 17:17322633-17322655 TGAGGGTGTTTGGGACCAGGTGG + Intronic
1146629278 17:34458415-34458437 CTGGGGTGTCCAGGACTTGGTGG + Intergenic
1148339246 17:46863604-46863626 TAGAGCTGTCTGGGACCTCGGGG + Intronic
1148839127 17:50483514-50483536 TTGGGGTGTGGGGATCCTGGAGG - Intronic
1150789884 17:68195568-68195590 TCAGTGTGTCTGAGACCTGGTGG - Intergenic
1151039305 17:70840149-70840171 TTGTGGTGTGAGGGACCTGGTGG - Intergenic
1151483266 17:74382981-74383003 TTGGTGTGGCCGGGACCTAGTGG + Intergenic
1151772507 17:76173637-76173659 TTGGGGAGGCTGGGGGCTGGGGG - Intronic
1152717945 17:81908849-81908871 GTGGCGGGGCTGGGACCTGGGGG - Intronic
1152790622 17:82277030-82277052 TGGAGGTGTCTGGGTCATGGGGG - Intergenic
1153728504 18:7981973-7981995 TCTGGGTGTCAGGGACCTAGTGG + Intronic
1154384570 18:13881163-13881185 TGGGGGTCTCTGGGAACTGCTGG - Intergenic
1155157439 18:23169439-23169461 TTCAGGTGGCTGGGACCTAGTGG - Intronic
1156749330 18:40431507-40431529 TTGGGGTGTCTATGCCCTGAGGG - Intergenic
1157589061 18:48825233-48825255 ATGGGATTTCTGGGGCCTGGAGG - Intronic
1158524329 18:58198528-58198550 GTGGAGTGTCGGGGAGCTGGGGG + Intronic
1160431834 18:78818310-78818332 TTGGAGTCCCTGGGAGCTGGGGG + Intergenic
1160531544 18:79567873-79567895 CTGGGGTGTTGGGGACGTGGAGG + Intergenic
1160543369 18:79637809-79637831 TTGGGGCCTCGGGGACCCGGCGG + Intergenic
1160620827 18:80169453-80169475 AGGGGGTGTCTGTGTCCTGGTGG - Exonic
1161435810 19:4262119-4262141 GTGGGGTGCCTGAGTCCTGGGGG + Intronic
1161473723 19:4473416-4473438 TGGGAGGGTCTGGGACCTGAGGG + Intronic
1162780169 19:13002597-13002619 CTGGGGTGTCTGGCTTCTGGTGG + Intronic
1162955709 19:14096814-14096836 ATGGGGATTCTGGGGCCTGGTGG + Intronic
1163368143 19:16887805-16887827 TGGGGGGGTCTGGGAGCAGGAGG - Intergenic
1163547679 19:17949319-17949341 TGCGGGTGTCTGGGACCCGCGGG - Intergenic
1164287986 19:23839366-23839388 TCAGGGTGTCAGGGACGTGGGGG + Intergenic
1164633812 19:29778492-29778514 TGGGGGTGTGTGGGCCTTGGAGG + Intergenic
1164809954 19:31147914-31147936 TAGGGGTCTCTGGAGCCTGGAGG + Intergenic
1166041321 19:40204669-40204691 TTGGAGTGGCAGGGACCTGTGGG + Intronic
1166449646 19:42887377-42887399 TGGGGGTGTTTGGGTCATGGGGG + Intronic
1166605794 19:44141673-44141695 TGGGGCTCGCTGGGACCTGGTGG + Exonic
1166624187 19:44334978-44335000 TTGGTGGGTCTGGGGTCTGGAGG - Intronic
1166875136 19:45892312-45892334 CTGGGGTGTCTGGGCACTGGTGG + Intronic
1167410210 19:49339798-49339820 GTGGGGTGGCTGGGGCATGGCGG + Intronic
1167412836 19:49355279-49355301 TTGGGGATTGTGGGACGTGGGGG - Intronic
1168103068 19:54151351-54151373 CTGGGCTGTGTGGGACATGGTGG + Intronic
1168152426 19:54456212-54456234 GTGGCGCGTCGGGGACCTGGAGG - Exonic
1202713053 1_KI270714v1_random:27920-27942 TAGGGATGTCTGGGGCCTGCAGG - Intergenic
925008539 2:465108-465130 TTGGGGGCTCTGAGACCTGCTGG - Intergenic
925115869 2:1377936-1377958 TTGTGGTGGGAGGGACCTGGTGG + Intronic
927084033 2:19656780-19656802 TGGGGTTGTCTGAGACCTTGGGG - Intergenic
927146515 2:20169712-20169734 ATGGGGTAACTGGGACCTGATGG - Intergenic
929376220 2:41289714-41289736 TTAGGGTGTCTGGTATCTGGTGG - Intergenic
931452390 2:62379172-62379194 TTGGGGCTTCTGGGAGGTGGCGG + Intergenic
933275192 2:80276801-80276823 TGGGGGTGTTTGGGTCATGGGGG - Intronic
935215375 2:100971521-100971543 ATAGGGTGCCTGGGTCCTGGAGG - Intronic
936976298 2:118224998-118225020 TGGGGGCGACTGGGACCAGGTGG + Intergenic
938978811 2:136506376-136506398 TTAGGGTGTCTGAGTCCAGGAGG + Intergenic
942224869 2:173806235-173806257 TGTGGGTGTCTGGGAGGTGGGGG - Intergenic
944530917 2:200667374-200667396 TTTGCGTGTCTCGAACCTGGAGG + Intronic
946431467 2:219629009-219629031 TTGGGGGGTCATGGCCCTGGAGG + Intronic
947603769 2:231470511-231470533 CTGGGGTGACTGGGAGCTGAGGG - Intronic
948561918 2:238860017-238860039 TGGGGGAGTCTGGTACCTGATGG + Intronic
948827046 2:240577911-240577933 TTGTGGTGTCTGGGAGGTCGAGG - Exonic
1168892764 20:1305632-1305654 TTGGGGTCTCTGGGCCCTGAAGG - Exonic
1170522109 20:17197439-17197461 GTGGGGTGTCTGGGCACAGGTGG - Intergenic
1171038695 20:21739736-21739758 TTGGGCTGCATGGGAGCTGGGGG - Intergenic
1172314616 20:33944029-33944051 TTCTGGTGTCTGGGACTGGGTGG + Intergenic
1173167181 20:40693405-40693427 CTTGGGTTTCTGGGTCCTGGTGG + Intergenic
1173472520 20:43334785-43334807 GTGAGGTGTCTGGGTCATGGGGG + Intergenic
1173834747 20:46118051-46118073 TTGGCCTTTGTGGGACCTGGGGG + Intergenic
1174056469 20:47801867-47801889 TAGGGGAGCCTGGGAGCTGGTGG + Intergenic
1174363066 20:50040430-50040452 TTGGGGTCTCTAGGCACTGGGGG + Intergenic
1175125649 20:56749426-56749448 CTGGGGTGTGGGGGACCTTGGGG + Intergenic
1178920553 21:36735662-36735684 TTGTGGTGTTTGGGTCCTGATGG + Intronic
1179169540 21:38962350-38962372 CTGTGGTGTCTTGGACCAGGGGG - Intergenic
1181025083 22:20123340-20123362 TTGGGGTGTGTGGTGTCTGGGGG + Intronic
1181025091 22:20123365-20123387 TTGGGGTGTGTGGTGTCTGGGGG + Intronic
1181431563 22:22884771-22884793 GTGGAGTTTCTGGGACCTGGGGG + Intronic
1182355914 22:29722167-29722189 TTGGGGTGGTGGGGTCCTGGTGG - Intronic
1183759032 22:39799026-39799048 GTGGTGTGTCTGGGCCCTGGAGG + Intronic
1184663023 22:45974297-45974319 TTGGGGAGTCTGGGACCAATGGG - Intronic
1185060209 22:48602730-48602752 TTGAAGTGTCCGGGACCTGCTGG + Intronic
949949543 3:9217842-9217864 TTGGGGGGCCTGGGGCCTGCAGG - Intronic
950490884 3:13304250-13304272 TTAGGGTGGCTGGTTCCTGGAGG + Intergenic
950558553 3:13709202-13709224 TTGGGGTGGAGGGCACCTGGAGG + Intergenic
950923198 3:16715852-16715874 TGGGGTTGTGTGGGACCCGGGGG + Intergenic
952525661 3:34207947-34207969 TTTGGTTGTCTGGGACCATGTGG + Intergenic
953498857 3:43413344-43413366 TGGGGGTGTCTGGATCATGGGGG + Intronic
953933308 3:47018076-47018098 CTGGGTTCTCTGGGCCCTGGAGG + Intronic
954374134 3:50185347-50185369 TAGGGGGGTTTGGGCCCTGGTGG + Intronic
955437847 3:58922434-58922456 TGGGGGTGTTTGGGTCATGGAGG + Intronic
957199826 3:77118975-77118997 TTGGGGAGTAAGGGACCTGGTGG + Intronic
959604074 3:108222682-108222704 TTGAGGTGTGTTGGACCTGGTGG + Intergenic
961697135 3:128713164-128713186 TTGGGGTGTTTGGGTCATGGAGG - Intergenic
962031803 3:131608859-131608881 TGGGGGTGTCAGGGAGGTGGGGG - Intronic
962746175 3:138398787-138398809 AGAAGGTGTCTGGGACCTGGGGG + Intronic
963151890 3:142053250-142053272 TGGGGGTGTTTGGGTCATGGGGG + Intronic
967955896 3:194876937-194876959 CTGGGGTGTGTGGGAAGTGGTGG + Intergenic
969608093 4:8212229-8212251 GTGGGGAGTCTGGGACCATGGGG - Intronic
970716864 4:18936655-18936677 TTGTAGTGTCTGGTACCGGGGGG - Intergenic
971366082 4:25978109-25978131 CTGGGGTTTCAGGGACCGGGAGG + Intergenic
971569543 4:28193529-28193551 TTGATGTGGGTGGGACCTGGTGG - Intergenic
972480174 4:39489234-39489256 TCGGGTGGTCTGGGTCCTGGTGG - Intergenic
972543324 4:40057331-40057353 GGGGTGTGTCTGGGGCCTGGAGG - Intronic
977071832 4:92400271-92400293 TGGTGGTTTCTGGGAACTGGAGG - Intronic
977449523 4:97177017-97177039 TGGGGGTGTTTGGGTCATGGAGG - Intergenic
978132351 4:105214222-105214244 GTGGGGTGTGTTGGACCTCGGGG + Intronic
978683712 4:111414670-111414692 TGGGTGTGTGTGGGACCTGTGGG + Intergenic
985110173 4:186540196-186540218 ATGGGTTGTCAGGGACCTGGTGG - Intronic
985714107 5:1446023-1446045 TTGGGGTCTCCGCGACCTCGAGG + Intergenic
985899946 5:2780520-2780542 TTGAGGTGTGTGGGACCCGAGGG - Intergenic
985933171 5:3075366-3075388 TTTAGGTGTCTGGCAGCTGGTGG - Intergenic
986267368 5:6202200-6202222 TTGCGTTGTCTGGGAGGTGGAGG - Intergenic
991703374 5:69335616-69335638 TGGGCTTGTCTGGGACGTGGGGG - Intergenic
991920608 5:71653013-71653035 TTGAGGTGTCTGGGGCCTGGAGG + Intronic
995549360 5:113265636-113265658 CCGGGGTCTCTGGGAACTGGAGG + Intronic
997813220 5:136992488-136992510 TTGGGCTGTGTTGGAGCTGGTGG + Exonic
998041430 5:138953158-138953180 TTTGGGTCTCTGGGAGCTTGTGG - Intronic
998171133 5:139872572-139872594 TGGGGCTGTCCGAGACCTGGAGG - Intronic
1001177165 5:169481066-169481088 TTGGATTGTATGGGAGCTGGAGG - Intergenic
1002522811 5:179800781-179800803 GTGGGGAGGCAGGGACCTGGTGG - Intronic
1003003397 6:2358431-2358453 TAGGGGTGTCCAGGGCCTGGGGG - Intergenic
1004310085 6:14537721-14537743 TTGGGAGCTCTGGAACCTGGAGG - Intergenic
1004343001 6:14823835-14823857 TTGCGGTGTTTGGGATATGGAGG + Intergenic
1005861960 6:29908571-29908593 CTGGGGTGCCAGGGACCAGGAGG + Intergenic
1006021782 6:31121636-31121658 CAGGGGTGTCTGAGGCCTGGGGG - Intronic
1007077969 6:39079789-39079811 GTGGGAAGACTGGGACCTGGAGG + Intronic
1007203593 6:40131427-40131449 CTAGGGTGTCTGGGGGCTGGTGG + Intergenic
1007740272 6:44005513-44005535 TGGGGGTGTGAGGAACCTGGAGG + Exonic
1010633696 6:78231137-78231159 TTGGATTGTGTGGGAGCTGGGGG - Intergenic
1011137541 6:84116260-84116282 TTGTTGTGTGAGGGACCTGGTGG + Intergenic
1011910739 6:92434188-92434210 GGGGGGTGTTTGGGTCCTGGGGG + Intergenic
1012269570 6:97192093-97192115 CTGGGGTGTCTGTTACATGGAGG - Intronic
1013152411 6:107459296-107459318 TGGAAGGGTCTGGGACCTGGGGG + Exonic
1013174331 6:107664255-107664277 TTGTGGTGCCTGGCACGTGGAGG - Intergenic
1013192281 6:107813825-107813847 CTAGGGTGGCTGGGACTTGGTGG + Intronic
1015790136 6:136957804-136957826 TGGGGGAGTCTGGGACTGGGTGG - Intergenic
1015857972 6:137645998-137646020 TCGGGGTGTGTGGGACCCAGCGG + Intergenic
1016747820 6:147599915-147599937 TAGGTGTGTATGGGACCAGGAGG + Intronic
1019256216 7:53820-53842 TTGGGGTGACAGTCACCTGGGGG + Intergenic
1019320235 7:411870-411892 GTGGGGTGTGCGGGTCCTGGGGG - Intergenic
1020439489 7:8202004-8202026 TTGGGCTGACTGTGTCCTGGGGG - Intronic
1023027239 7:36061894-36061916 TCTGGGTTTCTGGGACCTGTGGG - Intergenic
1024544353 7:50504791-50504813 TTGGGCAGTCTGGGCCCTGCTGG - Intronic
1024858581 7:53811723-53811745 TTTGGGGGCCTGGGACGTGGCGG - Intergenic
1027991577 7:85369657-85369679 ATGAGGTGTTTGGGACATGGGGG - Intergenic
1028176931 7:87671173-87671195 GTGGGGTGTGTGGGACCTGTGGG + Intronic
1030257396 7:107525856-107525878 GTGTGGTGGCTGGTACCTGGAGG - Intronic
1032095649 7:128937497-128937519 AAGGGGTGTCTGGATCCTGGGGG + Intergenic
1034103798 7:148473417-148473439 CCGGGGTGAATGGGACCTGGTGG - Intergenic
1035050543 7:155996343-155996365 GGGAGGTGTCTGGGTCCTGGGGG + Intergenic
1035272603 7:157729372-157729394 GTGGGGGGTCCGGGACCTGAAGG - Intronic
1035607499 8:939273-939295 CTGGGGTGCCTGGGAGTTGGAGG + Intergenic
1035832509 8:2712656-2712678 CTGGGGAGTCTGCCACCTGGAGG - Intergenic
1039468744 8:37800998-37801020 TTGGGGAGTCTGAGTGCTGGGGG + Intronic
1039854800 8:41402906-41402928 TGGGGATGACTGGGATCTGGTGG - Intergenic
1041773844 8:61502456-61502478 CTAGGGTGTCTGGCTCCTGGCGG - Exonic
1043132097 8:76474276-76474298 TTGGGGCTTCTGGGAGGTGGTGG + Intergenic
1045166335 8:99609969-99609991 ATAGGGTCTCTGGGACCTCGGGG + Intronic
1048551968 8:135441864-135441886 TTGTTGTGGGTGGGACCTGGTGG - Intergenic
1049077083 8:140406970-140406992 AAGGGGTGCCTGGTACCTGGGGG - Intronic
1049339959 8:142106788-142106810 ATGAGGTTTCAGGGACCTGGAGG + Intergenic
1049352113 8:142169973-142169995 TGAGGGTGTCTGGCCCCTGGGGG - Intergenic
1049410540 8:142471985-142472007 TGTGGGTGCCTGGGACCTGGTGG + Intronic
1049438092 8:142596927-142596949 CTGGGATGCCTGGGACATGGCGG + Intergenic
1049541075 8:143209285-143209307 TAGGGGTGCCTGGGAGCTGCAGG + Intergenic
1049553227 8:143270241-143270263 TTGGGGAGTCAGAGTCCTGGTGG + Intronic
1051121501 9:13756997-13757019 TTAGGGTGCCTGGAACCTAGGGG + Intergenic
1051694273 9:19751467-19751489 TTTGGTGGGCTGGGACCTGGAGG + Intronic
1052996098 9:34552292-34552314 TGGGGGTGCCAGGGAGCTGGTGG + Exonic
1055937901 9:81620527-81620549 TTAGACTGTCTGGGACCAGGAGG + Exonic
1056950189 9:91035538-91035560 TTAGGGTGGCTGGGACATGCAGG - Intergenic
1057025883 9:91733551-91733573 TTGGGGAGTCTGGGGCGGGGCGG - Intronic
1057438239 9:95062269-95062291 CAGGGGTGCTTGGGACCTGGTGG + Intronic
1058323667 9:103667116-103667138 TAGTGGTGTCTTGGACCAGGGGG + Intergenic
1058682375 9:107451230-107451252 CTGGGGTGTGGGGGACGTGGTGG + Intergenic
1058874739 9:109234172-109234194 TGGGGGTGTCTGTGAGCTGGGGG + Intronic
1059086418 9:111307619-111307641 TTTGGCTTTCTGGGAGCTGGTGG - Intergenic
1060136922 9:121166463-121166485 TTGGGGTTTCAGGGACCAGATGG + Intronic
1061299314 9:129695628-129695650 TTGGGGTGGCGGGGGCCTGGAGG - Intronic
1061585873 9:131568051-131568073 TTGGGGTGTTGGGAACCTGCTGG + Intergenic
1062030528 9:134359996-134360018 TAGGGGTGTGTAGGACCGGGCGG + Intronic
1203568681 Un_KI270744v1:111939-111961 TAGGGGTCTCTGGGAGCTGCAGG - Intergenic
1186166761 X:6834881-6834903 TGGAGGTGTTTGGGTCCTGGAGG - Intergenic
1186334337 X:8570481-8570503 ATGGGGTGAGTGGGAACTGGAGG - Exonic
1189462409 X:41253284-41253306 TTCGGGTGTCTGGCACCTGCTGG - Intergenic
1189982217 X:46522229-46522251 TTGTGGTGTCTGGGTTCTGGAGG - Intronic
1190107307 X:47569709-47569731 TTGGGGTGTGTGGGGCCAAGTGG + Intronic
1190533655 X:51406345-51406367 CTGAGGTGTGTGGGACCTGGGGG + Intergenic
1190598092 X:52066301-52066323 TGAGGGTATCTGGGACCTCGGGG + Exonic
1190610732 X:52187772-52187794 TGAGGGTATCTGGGACCTCGGGG - Exonic
1190700957 X:52989656-52989678 TTGGGGAGACAGGGACCAGGAGG - Intronic
1191596654 X:62951559-62951581 TTGGGGTATGGGGGGCCTGGGGG + Intergenic
1191738885 X:64416698-64416720 TGGGGGTGGGTGGGACCTGTGGG + Intergenic
1192926383 X:75759086-75759108 TTGGAGTTTCTGGTACCTGGAGG - Intergenic
1193626858 X:83833023-83833045 ATTGGATGTGTGGGACCTGGTGG + Intergenic
1194213095 X:91092718-91092740 TCGGGGTGTGTGGGACCTGTAGG + Intergenic
1194781439 X:98029201-98029223 TGGGGGTGTGTAGGACCTGTGGG + Intergenic
1197643578 X:128993226-128993248 AGTGGGTGTGTGGGACCTGGTGG + Intergenic
1199218545 X:145290067-145290089 TGGGGTAGTCCGGGACCTGGGGG + Intergenic
1201429076 Y:13887459-13887481 ATGGGGTGAGTGGGAACTGGAGG + Intergenic
1201632452 Y:16084266-16084288 TTGGGGCGTGTGGGGCTTGGAGG - Intergenic