ID: 1122505572

View in Genome Browser
Species Human (GRCh38)
Location 14:102229795-102229817
Sequence CCCTTGGGGTGTCTGGGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 243}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122505572_1122505592 25 Left 1122505572 14:102229795-102229817 CCAGGTCCCAGACACCCCAAGGG 0: 1
1: 0
2: 1
3: 18
4: 243
Right 1122505592 14:102229843-102229865 GGGGAGGCCAAACCTTCAGGGGG 0: 1
1: 0
2: 0
3: 17
4: 122
1122505572_1122505590 23 Left 1122505572 14:102229795-102229817 CCAGGTCCCAGACACCCCAAGGG 0: 1
1: 0
2: 1
3: 18
4: 243
Right 1122505590 14:102229841-102229863 CGGGGGAGGCCAAACCTTCAGGG 0: 1
1: 0
2: 0
3: 4
4: 284
1122505572_1122505581 4 Left 1122505572 14:102229795-102229817 CCAGGTCCCAGACACCCCAAGGG 0: 1
1: 0
2: 1
3: 18
4: 243
Right 1122505581 14:102229822-102229844 GCTGCCCACTAGAGTCCCACGGG 0: 1
1: 0
2: 0
3: 9
4: 110
1122505572_1122505591 24 Left 1122505572 14:102229795-102229817 CCAGGTCCCAGACACCCCAAGGG 0: 1
1: 0
2: 1
3: 18
4: 243
Right 1122505591 14:102229842-102229864 GGGGGAGGCCAAACCTTCAGGGG 0: 1
1: 0
2: 0
3: 14
4: 145
1122505572_1122505589 22 Left 1122505572 14:102229795-102229817 CCAGGTCCCAGACACCCCAAGGG 0: 1
1: 0
2: 1
3: 18
4: 243
Right 1122505589 14:102229840-102229862 ACGGGGGAGGCCAAACCTTCAGG 0: 1
1: 0
2: 0
3: 9
4: 59
1122505572_1122505580 3 Left 1122505572 14:102229795-102229817 CCAGGTCCCAGACACCCCAAGGG 0: 1
1: 0
2: 1
3: 18
4: 243
Right 1122505580 14:102229821-102229843 GGCTGCCCACTAGAGTCCCACGG 0: 1
1: 1
2: 2
3: 26
4: 247
1122505572_1122505586 9 Left 1122505572 14:102229795-102229817 CCAGGTCCCAGACACCCCAAGGG 0: 1
1: 0
2: 1
3: 18
4: 243
Right 1122505586 14:102229827-102229849 CCACTAGAGTCCCACGGGGGAGG 0: 1
1: 0
2: 0
3: 2
4: 67
1122505572_1122505583 6 Left 1122505572 14:102229795-102229817 CCAGGTCCCAGACACCCCAAGGG 0: 1
1: 0
2: 1
3: 18
4: 243
Right 1122505583 14:102229824-102229846 TGCCCACTAGAGTCCCACGGGGG 0: 1
1: 0
2: 0
3: 1
4: 62
1122505572_1122505582 5 Left 1122505572 14:102229795-102229817 CCAGGTCCCAGACACCCCAAGGG 0: 1
1: 0
2: 1
3: 18
4: 243
Right 1122505582 14:102229823-102229845 CTGCCCACTAGAGTCCCACGGGG 0: 1
1: 0
2: 0
3: 4
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122505572 Original CRISPR CCCTTGGGGTGTCTGGGACC TGG (reversed) Intronic
900250151 1:1664673-1664695 CCCTTGGGGAGAGTGGGACAGGG + Exonic
900261183 1:1730579-1730601 CCCTTGGGGAGAGTGGGACAGGG + Intronic
900357802 1:2273159-2273181 ACCTGGGGGTGTCTGGGCCTTGG + Intronic
900744236 1:4350580-4350602 CCCCTGGGTTGTCAGGGTCCAGG + Intergenic
902335329 1:15751269-15751291 CCCCTCGGGTGGGTGGGACCTGG - Intergenic
902385120 1:16071999-16072021 CCTTTGGGGTTTCTGGAGCCTGG + Intronic
902437905 1:16409852-16409874 CTTCTGGGCTGTCTGGGACCGGG + Exonic
902445623 1:16461967-16461989 ACCTTGTGGGGTCTGGGGCCAGG + Intergenic
902704817 1:18197295-18197317 CCTGTGGGGTGTCTGGACCCAGG + Intronic
902732827 1:18380900-18380922 AGCTTGGTGTGTCTGGCACCTGG - Intergenic
902884159 1:19393061-19393083 CCCTTGGGGAGTTGGGGAGCAGG - Intronic
903677162 1:25071659-25071681 TCCTTGGGGTGTGTGGGGCTGGG - Intergenic
903807943 1:26018731-26018753 CCACTGCGGTGGCTGGGACCAGG - Intergenic
907076830 1:51586752-51586774 CCCTTGGGGTGGCTGGTCCCAGG + Intronic
908210140 1:61891885-61891907 CCCTTTGTGTGTCTTGCACCAGG + Intronic
910818923 1:91325037-91325059 CTCTTGGGGTCTCTGAGTCCAGG + Intronic
910895724 1:92067168-92067190 CTCTAGGGGTGCCTGGGACAGGG + Intergenic
911174112 1:94802325-94802347 CCCTGGGGCAGGCTGGGACCAGG - Intergenic
916072352 1:161177567-161177589 GCCACGCGGTGTCTGGGACCGGG - Exonic
916991560 1:170250732-170250754 CCCTTGGGCAGGATGGGACCTGG + Intergenic
919240595 1:194911369-194911391 GGCTTGGGGTGGATGGGACCAGG - Intergenic
920109225 1:203575406-203575428 CCATTGGGATCTTTGGGACCTGG - Intergenic
921126057 1:212179241-212179263 CCCTAGAGGTGTTTGGGAACAGG - Intergenic
922396089 1:225202498-225202520 CCTTTGGGTTGTGTGGGAGCTGG - Intronic
922803226 1:228373436-228373458 GCGTTGGGGTGTCTGGGGTCAGG - Intronic
1067332501 10:45334661-45334683 CCCTTGTGGTGGCTGCCACCAGG - Intergenic
1067672064 10:48332577-48332599 CCTTAGGGATGTCTGGGATCAGG + Intronic
1069079249 10:64070207-64070229 CCCTTGAGGTGTGTGGAACTGGG + Intergenic
1069950461 10:72014878-72014900 CCCGTGGGCTCTCTGGGACAGGG + Intergenic
1070723823 10:78774675-78774697 CCTTTGGGCTTTCTGGGACTTGG - Intergenic
1073099327 10:100998645-100998667 CCCTAGGGGTCTCGGTGACCCGG - Intronic
1073262129 10:102198427-102198449 CCTTAGGGATGTCTGGGATCAGG + Intergenic
1074412953 10:113243658-113243680 CCCTTAGGGTCCCTGGGTCCTGG + Intergenic
1075424002 10:122327646-122327668 CCCTTGGGGCCTCTGGGAAGTGG - Intronic
1076058190 10:127392500-127392522 GGCAGGGGGTGTCTGGGACCTGG - Intronic
1076197834 10:128532811-128532833 CTCTTGGTGGGTCTGGGATCAGG + Intergenic
1076852467 10:133099787-133099809 CCCTGGCTGTGTCTGGGCCCTGG - Intronic
1077008778 11:370885-370907 CCCTTGGCCTGTGTGGGTCCAGG - Intronic
1077161280 11:1113710-1113732 CCCTAGGGGTGACTCGGGCCAGG + Intergenic
1077321205 11:1942893-1942915 CCCCTGGGCTGTCTGGTTCCTGG + Intergenic
1077412783 11:2411179-2411201 CCTTTGGGGTGTGGGGGGCCTGG + Intronic
1081617996 11:44601748-44601770 CCCTTGGGGTGGGTGGGGCTCGG - Intronic
1081997439 11:47374629-47374651 TCCTCAGGGCGTCTGGGACCCGG - Intronic
1082010673 11:47447995-47448017 GCCTTGGGCTGCCTGGTACCAGG - Exonic
1082835226 11:57646458-57646480 CCCTTGGGCTGTCTGGGGACTGG - Intronic
1082954682 11:58857398-58857420 CCCTGGGTGATTCTGGGACCTGG + Intronic
1083204238 11:61138495-61138517 CTCCTGGGGTATCTGGGTCCTGG + Intronic
1083640042 11:64140496-64140518 CCCTTGGTGGGGCTGGGAACGGG - Intronic
1088424942 11:109692921-109692943 CTCAGGGGGTGCCTGGGACCCGG - Intergenic
1088587028 11:111368350-111368372 CACTTAGAGTGTCTGGGACAAGG - Intronic
1089366954 11:117926314-117926336 TCCTTGGGGTGCCTGGGGCTGGG + Intronic
1090753008 11:129763838-129763860 CCTTTGGGTTGTGTGGGAGCTGG + Intergenic
1091831680 12:3554657-3554679 CCCTTGAGGGGTCTGGGGCAGGG + Intronic
1092167102 12:6348916-6348938 CCCTTCTTGTGGCTGGGACCAGG + Intronic
1093277568 12:17148700-17148722 CCTTTGGGTTGTATGGGAGCTGG + Intergenic
1095699713 12:45178435-45178457 CCCTTTGGGTTTCTTGGATCTGG - Intergenic
1097899252 12:64857045-64857067 CTCTTGGGGTCTCTGAGTCCAGG - Intronic
1098509925 12:71299695-71299717 CCGTGGGAGTGTATGGGACCTGG - Intronic
1099473043 12:83074646-83074668 CCTTTGGTTTGTATGGGACCTGG - Intronic
1101517004 12:105446094-105446116 CCCTTGGGGCCTTTGTGACCTGG + Intergenic
1102002633 12:109566919-109566941 CCCTTGGTGTGTGTGGGAGGGGG - Intronic
1102871614 12:116418556-116418578 CCCTTGGAGTTCCTGGGATCTGG - Intergenic
1103590518 12:121989231-121989253 CCCTGGAGGTGTTTGAGACCTGG + Intronic
1103702033 12:122853239-122853261 CCCTGGGGGTGTCAGGGGCAGGG + Intronic
1103702047 12:122853270-122853292 CCCTGGGGGTGTCAGGGGCAGGG + Intronic
1103702061 12:122853301-122853323 CCCTGGGGGTGTCAGGGGCAGGG + Intronic
1103702075 12:122853332-122853354 CCCTGGGGGTGTCAGGGGCAGGG + Intronic
1103702089 12:122853363-122853385 CCCTGGGGGTGTCAGGGGCAGGG + Intronic
1103702103 12:122853394-122853416 CCCTGGGGGTGTCAGGGGCAGGG + Intronic
1103702117 12:122853425-122853447 CCCTGGGGGTGTCAGGGGCAGGG + Intronic
1103702131 12:122853456-122853478 CCCTGGGGGTGTCAGGGGCAGGG + Intronic
1103702145 12:122853487-122853509 CCCTGGGGGTGTCAGGGGCAGGG + Intronic
1103702159 12:122853518-122853540 CCCTGGGGGTGTCAGGGGCAGGG + Intronic
1103918165 12:124386471-124386493 CCCTTAGGGAGTTTGGGCCCTGG - Intronic
1104728523 12:131092621-131092643 GCCTTGGGGTGGCTCTGACCTGG + Intronic
1107860039 13:44651794-44651816 CCCCTGGGATGTGTGGGACCTGG + Intergenic
1107964625 13:45587867-45587889 TCCTTGGGGTGTCTTGGCCCTGG + Intronic
1108935404 13:55875439-55875461 CCTTAGGGATGTCTGGGATCAGG + Intergenic
1113798800 13:113075815-113075837 CCCTTGGGGTGCTTTGGACAGGG + Intronic
1113943711 13:114032496-114032518 CCCTCGGGGTGCCTGGGTCGTGG + Intronic
1114065368 14:19054980-19055002 CCCTCAGGCCGTCTGGGACCGGG - Intergenic
1114096894 14:19345022-19345044 CCCTCAGGCCGTCTGGGACCGGG + Intergenic
1114663855 14:24367423-24367445 CCCTCTGGGTGGCTGGGACAAGG + Intronic
1115265139 14:31492956-31492978 CCTTTGGATTGTGTGGGACCTGG + Intronic
1117112741 14:52475504-52475526 CCTTTGGGTTGTGTGGGAGCTGG + Intronic
1119857300 14:77910126-77910148 GCCTTGGGGTGTGTGGGATATGG + Intronic
1121447354 14:93987560-93987582 CCCTTGGGCCGTCTGGGCCCTGG + Intergenic
1121546523 14:94767626-94767648 CCCTAGGGCTGACCGGGACCAGG - Intergenic
1122297559 14:100713893-100713915 TCCTTGTGGTGCCTGGGAGCAGG - Intergenic
1122505572 14:102229795-102229817 CCCTTGGGGTGTCTGGGACCTGG - Intronic
1122794671 14:104200164-104200186 CCGTGGGGGTGTCTGGGCCTGGG + Intergenic
1122798042 14:104216204-104216226 CCCTTGGGGTGCCTGGGGCTCGG + Intergenic
1123671683 15:22664993-22665015 CGCTTGGGTGGCCTGGGACCCGG + Intergenic
1124623299 15:31292475-31292497 CCATGGGCTTGTCTGGGACCTGG + Intergenic
1125055958 15:35359190-35359212 CCCTTGGGTTTGCTGGGAGCTGG - Intronic
1125419207 15:39487380-39487402 CCCTGGGGGTTTCTGGTACAAGG - Intergenic
1127647353 15:60971887-60971909 CCATTGGGCTGTCTGGGCCAGGG + Intronic
1127734973 15:61831518-61831540 CAGCTGGTGTGTCTGGGACCTGG - Intergenic
1129880225 15:79001482-79001504 CCCTTGGGGTGGCGGGGGGCGGG + Intronic
1130453447 15:84080269-84080291 CTCTTGGTGTGGCCGGGACCCGG + Intergenic
1132522972 16:399950-399972 CCCTTGGGGTGTCAGGTAACAGG - Intronic
1132571862 16:647733-647755 GCGATGGGGTGCCTGGGACCTGG + Intronic
1132851740 16:2027865-2027887 CAGCTGGTGTGTCTGGGACCGGG + Intronic
1135406043 16:22198681-22198703 CCCTTGTGGTGGCTGGGCCACGG - Intergenic
1135976228 16:27110334-27110356 CCCTTGGGATCTCTGGGACCAGG + Intergenic
1137864453 16:51878822-51878844 CCCTTGTGGTGACTGGGAATTGG - Intergenic
1138266790 16:55665358-55665380 CCCTTGGGGTGTTGGGGAAGGGG + Intronic
1138389124 16:56657677-56657699 CCCTTGGGGTTCCGGGTACCTGG - Exonic
1138439990 16:57028434-57028456 CCCAGGGGGACTCTGGGACCTGG - Intronic
1139945230 16:70636526-70636548 CACTTGGGGAGGCTGAGACCAGG + Intronic
1140410893 16:74739760-74739782 CTCCAGGGGTGTCTGGGATCTGG + Intronic
1141485157 16:84334022-84334044 CCCTTAGGGTCTCTGAGTCCAGG + Intergenic
1143376417 17:6470215-6470237 CCCTTGGGGTGGCTGTGGGCAGG + Intronic
1144252272 17:13429505-13429527 CCCTGGGGGTGTCTACGATCAGG - Intergenic
1146629275 17:34458412-34458434 CCCCTGGGGTGTCCAGGACTTGG + Intergenic
1147119609 17:38328260-38328282 CCCTGGGGGAGTGTGGGTCCAGG - Exonic
1147420302 17:40319094-40319116 TGCTGAGGGTGTCTGGGACCTGG + Intronic
1148865579 17:50626498-50626520 CTCTTGGGGGGCCTGGGAGCCGG + Exonic
1149466514 17:56884307-56884329 CCCTTGGAGTCTCTGGGATTGGG - Intergenic
1150201366 17:63361332-63361354 CCCTTGGGAGGTGTGGGATCTGG - Intronic
1151039306 17:70840152-70840174 CCATTGTGGTGTGAGGGACCTGG - Intergenic
1151367595 17:73627513-73627535 CCCTTGGGGTCTCTGCTCCCTGG - Intronic
1152622046 17:81369854-81369876 GCTCTGGGGTGTCAGGGACCAGG - Intergenic
1152753713 17:82078209-82078231 GCCTAGGGGTGTGTGGGAACTGG + Intergenic
1152784918 17:82242534-82242556 GCCTGTGGGTGTCTGGGAGCTGG - Intronic
1154402749 18:14057208-14057230 CCCTTGGGGTTTGTGGCAGCTGG + Intergenic
1156029096 18:32691530-32691552 TCTTTGGGGGGTCTGGGAACAGG - Intronic
1158559856 18:58504888-58504910 TCCTTGGGGTGCCTTCGACCTGG - Intronic
1160833308 19:1113232-1113254 CCCTTGGGGTGCCCAGGGCCAGG - Intronic
1160919641 19:1513545-1513567 CGCTGGGGGTGACCGGGACCTGG - Intronic
1161047328 19:2142711-2142733 CCATTGGGGTGAGGGGGACCGGG - Intronic
1161318704 19:3631340-3631362 CAGAAGGGGTGTCTGGGACCTGG - Exonic
1161453573 19:4359630-4359652 CCCCATGGGTGTCTGGAACCAGG + Intronic
1161736584 19:5995471-5995493 CCCTTGGGGGGTGAGGGCCCTGG - Intronic
1162099931 19:8333505-8333527 CCCTTGGGGAGTCCGGGAGTGGG + Intronic
1162751071 19:12829851-12829873 CCCATGGTGTTGCTGGGACCTGG + Exonic
1163311377 19:16516967-16516989 CCCTTGGAGTGGCTGAGATCAGG - Intronic
1163575695 19:18109871-18109893 CCCTGGGGCTCTCTGGGAGCCGG - Intronic
1165722349 19:38088563-38088585 CACTGGGGGTGTCTGTGACCAGG + Intronic
1166010135 19:39935481-39935503 CCCTAGTGGTGTCTGGAAGCAGG - Intergenic
1166292665 19:41873066-41873088 CCCTTGGAGTGGCTAGGTCCAGG - Intergenic
925269455 2:2591912-2591934 CTCTTGGGGTGACTGAGTCCAGG + Intergenic
926138244 2:10352594-10352616 CCCTGGGGACGTCTGGGATCTGG + Intronic
926310918 2:11675691-11675713 GCCAGGGGGTGTCTGGGGCCAGG + Intergenic
928283911 2:29972453-29972475 CCCTTGGGGTGTCAGGGATATGG - Intergenic
932219179 2:69986946-69986968 GCCTTGTGGGGTCTGGGGCCTGG + Intergenic
934967830 2:98738213-98738235 CCTTTGGAGTGTCTGGGTGCTGG + Intergenic
935215377 2:100971524-100971546 CCCATAGGGTGCCTGGGTCCTGG - Intronic
937437033 2:121889287-121889309 CCCTTTGGGAGGCTGAGACCCGG + Intergenic
937828961 2:126399499-126399521 CCTTTGGGTTGTGTGGGAGCTGG - Intergenic
938180529 2:129178482-129178504 CCCTTGGCAGGCCTGGGACCCGG - Intergenic
938307251 2:130264558-130264580 TCCTTGGGGAGTCTCTGACCTGG + Intergenic
942783484 2:179673151-179673173 GGCTTGGGGTTTCTTGGACCAGG - Intronic
943129656 2:183839862-183839884 CCCTTCGGATGTGTGGGAGCTGG + Intergenic
943375272 2:187068661-187068683 CCCCTGGTGTGACTGGGTCCAGG + Intergenic
947439732 2:230108947-230108969 CTCTTGGGGTCTCTGAGTCCAGG - Intergenic
947956184 2:234193868-234193890 CCCTTTTGGTGTATGGGACAAGG + Intergenic
948237679 2:236402631-236402653 CCCCTGGTGTTTCTGGGTCCAGG - Intronic
948825323 2:240571083-240571105 CCTTGGGGGGGGCTGGGACCTGG - Intronic
949004884 2:241639686-241639708 CCCTTGGTGTGGCTGGGTCCAGG + Intronic
1171128907 20:22629897-22629919 CCCTTGGGTTGTCTTGGATGAGG + Intergenic
1171399471 20:24862838-24862860 CCCCTGGGGTCTCTGGCTCCAGG - Intergenic
1172802028 20:37582414-37582436 TCCTAGGGGTGACTGGGAGCTGG + Intergenic
1173251399 20:41365989-41366011 CCCATGGGGTTGCTGGGGCCAGG + Intronic
1174169829 20:48609315-48609337 CTCTTGGGCTGTCTGGGGCTGGG + Intergenic
1175786992 20:61718096-61718118 CCCTTGCCTTCTCTGGGACCAGG - Exonic
1175888111 20:62303479-62303501 CCCCTGGGGTGTTTGCGAGCAGG - Intronic
1176273112 20:64246756-64246778 CCCTGGGGGTGTCTGAGGCAGGG + Intergenic
1176285335 21:5016335-5016357 CCAGTGGGGTGGCTGGGAGCAGG + Intergenic
1176715796 21:10347831-10347853 CCCTGGGGGTCTCAGGGGCCTGG + Intergenic
1177176443 21:17704938-17704960 CCTTTGGGTTGTGTGGGAGCTGG + Intergenic
1177877341 21:26649714-26649736 CCTTTGTGAGGTCTGGGACCTGG - Intergenic
1179084225 21:38203288-38203310 CCTTTGGGGTGCATGGGAGCTGG - Intronic
1179161263 21:38901205-38901227 TCGTTGGGGTGTCTGGGAAAGGG - Intergenic
1179293558 21:40041135-40041157 CCCTTGGGTTTTATGGGACAAGG - Intronic
1179408379 21:41143605-41143627 CCCTATGGGTGTCTGGGCACAGG - Intergenic
1179871846 21:44247140-44247162 CCAGTGGGGTGGCTGGGAGCAGG - Intronic
1179909147 21:44438776-44438798 CCCTTGGGGAGTCTGAGCTCAGG + Intronic
1180181690 21:46121076-46121098 CCCTGGGGGCCTCTGGGTCCAGG - Exonic
1180483858 22:15777600-15777622 CCCTCAGGCCGTCTGGGACCGGG - Intergenic
1180602545 22:17032122-17032144 CCCTGGGGGTCTCAGGGGCCTGG - Intergenic
1181084956 22:20435632-20435654 CCCTGTGGGTGTCTGGGGCAAGG - Intronic
1183890821 22:40927089-40927111 CCATTTGGTTGCCTGGGACCTGG + Exonic
1184256090 22:43287914-43287936 CCATTGGGGAGACAGGGACCTGG - Intronic
1184623600 22:45703694-45703716 TCTTTGTGGTGTCTGGGACAAGG - Intronic
1184801420 22:46762742-46762764 CACTCGGGGTGTCTGGGCCGCGG + Exonic
1185138907 22:49089433-49089455 CCCTGGGGGAGTCCGGGGCCTGG - Intergenic
1185244029 22:49763804-49763826 TCCTTGGGGTGTTGGGGTCCAGG - Intergenic
949554937 3:5144651-5144673 CCTTAGGGATGTCTGGGATCAGG + Intronic
952422516 3:33144779-33144801 CCCTTGGGCTCTCTGGGAAATGG + Exonic
954286887 3:49625560-49625582 CCCTTGGGAGATCTGGGGCCAGG - Intronic
954374132 3:50185344-50185366 CCCTAGGGGGGTTTGGGCCCTGG + Intronic
954808274 3:53232657-53232679 GCCTTGGGGGGTTTGGAACCTGG - Intronic
955322745 3:57985948-57985970 CCCTTGGACTGTCTGGTTCCAGG + Intergenic
957199825 3:77118972-77118994 CACTTGGGGAGTAAGGGACCTGG + Intronic
958892295 3:99795264-99795286 CCCTTGGGCCCTATGGGACCTGG - Exonic
960397596 3:117156219-117156241 CCGCTGGAGTGACTGGGACCAGG - Intergenic
961000275 3:123369517-123369539 CCCTGTGAGTGTCTGGGAACTGG + Intronic
965329335 3:167351490-167351512 TGCTTGGGGTCACTGGGACCTGG + Intronic
965709853 3:171546202-171546224 CCCTTGGCCTCTCTGGGACTTGG - Intergenic
967344747 3:188442270-188442292 CTCTTGGGGTGTGTGGGGCTGGG - Intronic
968670807 4:1850335-1850357 CTCTTGGGGTGTCTGGAGTCAGG - Intronic
979213273 4:118132516-118132538 CTCTTGGGGTCTCTGAGTCCAGG - Intronic
984698928 4:182806377-182806399 CCCCTGGGGTTCCTGGGACTCGG + Intergenic
985110175 4:186540199-186540221 ACCATGGGTTGTCAGGGACCTGG - Intronic
985650661 5:1105807-1105829 GGCTGGGGGTGTCTGGGGCCTGG - Intronic
986128438 5:4905125-4905147 CCCATGGGGTTCCAGGGACCTGG + Intergenic
986917330 5:12637405-12637427 CCCATGTGTTGTGTGGGACCCGG - Intergenic
988825469 5:34930207-34930229 CCCTCGTGGTGTCTGCGACCCGG - Intronic
994710519 5:103259152-103259174 CCCTTCGGGTGCCTGGGAACCGG - Intronic
997610926 5:135215264-135215286 CCCTGGGGGTTTCTGAGACAGGG - Intronic
997851999 5:137341125-137341147 CCCTTGGGGAGACTGTGGCCTGG - Intronic
998681694 5:144474696-144474718 CCCTTGGGAGGTCTAGGCCCTGG - Exonic
999111123 5:149122114-149122136 CCATTGGGGTATCTGAGAGCAGG + Intergenic
1003829713 6:9994515-9994537 CACTTGGGGTGTCTGGGTAATGG + Intronic
1005861957 6:29908568-29908590 GCCCTGGGGTGCCAGGGACCAGG + Intergenic
1006161837 6:32043837-32043859 CCCCTGGAGTTTCTGGGTCCGGG + Exonic
1007393838 6:41565979-41566001 GCCTTGGGGTATCTGGGAGCGGG + Intronic
1009905004 6:69859457-69859479 CCCCTGGGATCTCTTGGACCAGG + Intergenic
1010676675 6:78753734-78753756 CTCTTGGGGTCCCTGGGTCCAGG + Intergenic
1019438089 7:1032008-1032030 GTCTTGGGGTGCCTGGGCCCAGG - Intronic
1019576611 7:1740651-1740673 CCCTTGGGGACTCCTGGACCCGG + Intronic
1021760343 7:23897317-23897339 CTCTTGGGGAGTGTGGGCCCAGG + Intergenic
1022025545 7:26444612-26444634 CCCCTTGGATGTCTAGGACCAGG + Intergenic
1022424129 7:30251865-30251887 CCCTTGGGGTTTCTCAAACCTGG - Intergenic
1022889547 7:34682352-34682374 CCCTGGGGGTGTCTAGGTTCAGG - Intronic
1023022951 7:36027325-36027347 CCCTTGGGGTGTCTGCTTCAAGG + Intergenic
1026123972 7:67563220-67563242 CCCTGGGGGTGGCTGGGGACTGG + Intergenic
1029600540 7:101560809-101560831 CCCTTTTGGTCTCTGGGTCCTGG - Intergenic
1029950074 7:104574775-104574797 CCCTAAGGGTGTATGGGACTGGG - Intronic
1032116494 7:129122047-129122069 GCCTTGGGGTCTCTGGGAAGTGG + Intergenic
1033913650 7:146296335-146296357 ACCTTGGGGAGTCTGGGACTAGG - Intronic
1035233840 7:157483939-157483961 TCCTTGGGGTCTCGGGGTCCAGG + Intergenic
1035282622 7:157787274-157787296 CCTCTGGGGTGTCGGGGATCAGG + Intronic
1037094447 8:14967230-14967252 CCCTGGTGGTGTCTGAGACCTGG + Intronic
1037910365 8:22740567-22740589 CCCCTGGGGTCTCTGGGCCAGGG + Intronic
1038032453 8:23654572-23654594 CCCTTGGAGTCTCTTGGAACAGG + Intergenic
1039829202 8:41199672-41199694 CCCTTGGGGTGTCAGTGTCCAGG - Intergenic
1040313465 8:46248828-46248850 CCCTGGGGGTTTCTGGGATGGGG - Intergenic
1041383827 8:57278944-57278966 CCCTCAGGCTTTCTGGGACCAGG + Intergenic
1043912949 8:85885027-85885049 CCCTTGGGTTATCTGGGGCATGG - Intergenic
1044016551 8:87053555-87053577 CTCTTTGGTTGTCTGGGTCCTGG + Intronic
1044907228 8:97017592-97017614 CCTTTGGGTTGCCTGGGAGCTGG + Intronic
1048146181 8:131846132-131846154 CCCTTGAGGAGTCTGAGACCAGG + Intergenic
1049394263 8:142391821-142391843 CCCTTGGCATGTGTGGGATCTGG + Intronic
1049410539 8:142471982-142472004 CGCTGTGGGTGCCTGGGACCTGG + Intronic
1050780486 9:9327987-9328009 CCCGTGGGCTGTATGGGCCCAGG - Intronic
1054982037 9:71217905-71217927 ACCTTGGAGTGACTGGGGCCTGG + Intronic
1055937900 9:81620524-81620546 CTCTTAGACTGTCTGGGACCAGG + Exonic
1059398400 9:114053373-114053395 CCTTTGGGGGATCTGGGACCAGG + Exonic
1060281175 9:122216662-122216684 CCCTCCGGTTGCCTGGGACCAGG - Intronic
1060328725 9:122644152-122644174 CTATTGGGGTCTCTGGGTCCAGG + Intergenic
1061504548 9:131024540-131024562 TCTTGGGGGTCTCTGGGACCAGG + Intronic
1061937472 9:133866138-133866160 CCCCTGGGGGGCCTGGAACCAGG - Intronic
1062043464 9:134414738-134414760 TCCTTAGGGTCTCAGGGACCTGG + Intronic
1062283385 9:135761924-135761946 CCCTGGGGGTGGCTGGGGCTGGG - Intronic
1062567508 9:137169862-137169884 GCCTTGGCCTGTCTGGGCCCAGG - Exonic
1190775124 X:53546503-53546525 CCCGGGGGGACTCTGGGACCCGG - Exonic
1192926385 X:75759089-75759111 ACCTTGGAGTTTCTGGTACCTGG - Intergenic
1193882064 X:86935889-86935911 ACCCTTGGGTGGCTGGGACCAGG + Intergenic
1194932167 X:99901498-99901520 CCTTTGGGTTGTGTGGGAGCTGG - Intergenic
1194993779 X:100571810-100571832 CCTTAGGGATGTCTGGGATCAGG + Intergenic
1199684963 X:150257604-150257626 CCCTTGGGGTGCATGTGACAGGG - Intergenic