ID: 1122505579

View in Genome Browser
Species Human (GRCh38)
Location 14:102229811-102229833
Sequence CTAGTGGGCAGCCACTCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 114}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122505579_1122505590 7 Left 1122505579 14:102229811-102229833 CCAAGGGAGTGGCTGCCCACTAG 0: 1
1: 0
2: 1
3: 11
4: 114
Right 1122505590 14:102229841-102229863 CGGGGGAGGCCAAACCTTCAGGG 0: 1
1: 0
2: 0
3: 4
4: 284
1122505579_1122505583 -10 Left 1122505579 14:102229811-102229833 CCAAGGGAGTGGCTGCCCACTAG 0: 1
1: 0
2: 1
3: 11
4: 114
Right 1122505583 14:102229824-102229846 TGCCCACTAGAGTCCCACGGGGG 0: 1
1: 0
2: 0
3: 1
4: 62
1122505579_1122505586 -7 Left 1122505579 14:102229811-102229833 CCAAGGGAGTGGCTGCCCACTAG 0: 1
1: 0
2: 1
3: 11
4: 114
Right 1122505586 14:102229827-102229849 CCACTAGAGTCCCACGGGGGAGG 0: 1
1: 0
2: 0
3: 2
4: 67
1122505579_1122505591 8 Left 1122505579 14:102229811-102229833 CCAAGGGAGTGGCTGCCCACTAG 0: 1
1: 0
2: 1
3: 11
4: 114
Right 1122505591 14:102229842-102229864 GGGGGAGGCCAAACCTTCAGGGG 0: 1
1: 0
2: 0
3: 14
4: 145
1122505579_1122505592 9 Left 1122505579 14:102229811-102229833 CCAAGGGAGTGGCTGCCCACTAG 0: 1
1: 0
2: 1
3: 11
4: 114
Right 1122505592 14:102229843-102229865 GGGGAGGCCAAACCTTCAGGGGG 0: 1
1: 0
2: 0
3: 17
4: 122
1122505579_1122505589 6 Left 1122505579 14:102229811-102229833 CCAAGGGAGTGGCTGCCCACTAG 0: 1
1: 0
2: 1
3: 11
4: 114
Right 1122505589 14:102229840-102229862 ACGGGGGAGGCCAAACCTTCAGG 0: 1
1: 0
2: 0
3: 9
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122505579 Original CRISPR CTAGTGGGCAGCCACTCCCT TGG (reversed) Intronic
900345549 1:2208697-2208719 CCTGTGGGCAGCAGCTCCCTGGG + Intronic
904701480 1:32361077-32361099 CTCCTGGGCAGCCTTTCCCTTGG - Intronic
906879582 1:49575715-49575737 CTAGTATGCAGCCACTGACTTGG + Intronic
907298447 1:53470360-53470382 CTAGTGGGAGGCCGGTCCCTAGG - Intergenic
912618176 1:111127984-111128006 CCAGTGGCTAGTCACTCCCTTGG + Intronic
914934691 1:151968288-151968310 CTGCTGGGCATCCACTCCCAGGG - Intergenic
915076568 1:153312794-153312816 CTAGAGGGCACTCCCTCCCTGGG + Intergenic
915080491 1:153348688-153348710 CTAGAGGGCACTCCCTCCCTGGG + Intronic
919766062 1:201127954-201127976 CTAGTGGGCCGCGTATCCCTGGG - Intergenic
922754872 1:228090203-228090225 CTTGAGGGCAGGCACTCCCAGGG - Intronic
1070760706 10:79022747-79022769 CTAGTGGGCAACCAATCCAGAGG + Intergenic
1071489997 10:86129777-86129799 CTTCAAGGCAGCCACTCCCTTGG + Intronic
1074136370 10:110630399-110630421 TTTGTGGGAACCCACTCCCTGGG + Intergenic
1074450214 10:113553352-113553374 CTTTTGAGCAGCCACTCCCATGG + Intronic
1074617220 10:115081344-115081366 CCTGCGGGCAGCCAGTCCCTAGG - Intergenic
1075780873 10:125016312-125016334 CTCATGGGCAGCCATCCCCTCGG - Intronic
1076313443 10:129524124-129524146 AGAGTGGGCAGCCACTCTTTTGG - Intronic
1076328822 10:129650198-129650220 CCAGTGGGTAGCCTCGCCCTGGG + Intronic
1078018563 11:7636405-7636427 CAAGTGGGCAGCCATTCCTTGGG + Intronic
1080308677 11:30864678-30864700 CTAGAGGGCAGGAACACCCTTGG - Intronic
1082698751 11:56402107-56402129 CTAGTGGGCTGGCACTGCTTGGG + Intergenic
1084943450 11:72626412-72626434 CTTGTTGGCAGCCACTCCCTTGG + Intronic
1088001801 11:104891105-104891127 AAAGTGCACAGCCACTCCCTGGG + Intergenic
1089632791 11:119794046-119794068 GTATTGGGCAGCTACTCCCATGG + Intergenic
1092275333 12:7056524-7056546 CTAGTGGGTTTCCAATCCCTGGG - Intronic
1093036196 12:14334570-14334592 CTAGTGTGCAGCCATTGACTTGG + Intergenic
1093419013 12:18952943-18952965 TTGGTGGGCAGCCAATACCTCGG + Intergenic
1093534185 12:20202959-20202981 CTGGTGGGCACAAACTCCCTTGG - Intergenic
1096653372 12:53073404-53073426 GCAGTGGGCATGCACTCCCTGGG - Exonic
1102700928 12:114838755-114838777 CTAGTGGTCAGCAGCCCCCTGGG - Intergenic
1104347311 12:128012295-128012317 ATGGCTGGCAGCCACTCCCTGGG + Intergenic
1114631949 14:24164802-24164824 CTAGTGGCCAGCAACCCCCGAGG + Exonic
1116384147 14:44310262-44310284 CTGGTGGGCAGCCCCTACCCAGG - Intergenic
1121409980 14:93743181-93743203 CGAGTGGGCTGCCACTCACAGGG - Intronic
1121494559 14:94383136-94383158 CTTCTGGGCAGCATCTCCCTGGG + Exonic
1122505579 14:102229811-102229833 CTAGTGGGCAGCCACTCCCTTGG - Intronic
1122786920 14:104168145-104168167 CTCCTGGGCAGCCACACCTTGGG + Intronic
1202940897 14_KI270725v1_random:144077-144099 ATAGTGGGTAGCTCCTCCCTAGG - Intergenic
1126915132 15:53457871-53457893 CTAGTGGTGAGTAACTCCCTAGG - Intergenic
1128396696 15:67233561-67233583 CTAGTGGCCAGCCTAGCCCTGGG + Intronic
1129335646 15:74850729-74850751 CAATGTGGCAGCCACTCCCTAGG + Intronic
1129468535 15:75737876-75737898 CCAGTGGCCAGACACCCCCTGGG + Intergenic
1129727045 15:77906631-77906653 CCAGTGGCCAGACACCCCCTGGG - Intergenic
1133125171 16:3641765-3641787 CCAGTGGGCAGCCCCACCCAGGG - Intronic
1137037468 16:35578676-35578698 CTAGAGATCAGCCTCTCCCTTGG + Intergenic
1137568910 16:49551872-49551894 CAAGTGGGAGGCCACTCTCTTGG - Intronic
1137754802 16:50892826-50892848 CTATTGGGCATCCACTCATTGGG - Intergenic
1144558901 17:16305665-16305687 CTGGAGGGCAGGCAGTCCCTTGG - Intronic
1147605553 17:41772029-41772051 GTCGTGGGCAGCCCCTCCCTGGG - Intronic
1149342545 17:55701460-55701482 CTGGTGGAAAGCCCCTCCCTGGG - Intergenic
1152277226 17:79364907-79364929 CTCCTGCCCAGCCACTCCCTGGG - Intronic
1152314826 17:79574004-79574026 CCAGTGGGCAGCCCACCCCTGGG - Intergenic
1152375423 17:79916219-79916241 CCAGGGGTCAGCCCCTCCCTGGG - Intergenic
1153938253 18:9951449-9951471 CTAGTGGGCAGTAATTGCCTTGG + Intronic
1161380839 19:3964209-3964231 CCAGTGGGCAGCCCCGGCCTGGG - Intronic
1165511108 19:36267266-36267288 CTTGTGGTCAGCCTCTCCCCGGG + Intergenic
925232173 2:2243113-2243135 CTTCAGGGCAGCCTCTCCCTTGG - Intronic
931442027 2:62296777-62296799 CGAGTGGCCAGCCACGCCCAGGG + Intergenic
934059920 2:88284102-88284124 CAGGTGCCCAGCCACTCCCTGGG + Intergenic
938540151 2:132278844-132278866 CTGGTGGGCTGCCTCACCCTTGG - Intergenic
942820988 2:180115067-180115089 TTATTGGGAAGCCACTTCCTGGG + Intergenic
944613950 2:201440881-201440903 CTAGTGGGCAGCCATCTTCTGGG - Intronic
946075472 2:217070169-217070191 CTACTGGGCAGCCACTCTGAGGG + Intergenic
946363617 2:219235036-219235058 CAAGGGGGCAGCAACTGCCTGGG - Exonic
946860507 2:223996582-223996604 GGAGTTGCCAGCCACTCCCTCGG + Intronic
947010140 2:225556690-225556712 CTGGTTGGCAGCTACTTCCTAGG + Intronic
947708309 2:232294001-232294023 AAAGTGGGCAGCCAGTGCCTTGG - Intronic
947808239 2:232983069-232983091 CCAGTGGGCAGCCATCCCCAGGG - Intronic
948776235 2:240290348-240290370 CCTGTGGGCAGCCACTCCATGGG - Intergenic
948854730 2:240724871-240724893 CTTGTGGGCAGTCAGTCCCATGG + Intronic
1169217521 20:3802136-3802158 CACCTGGGCAGCCACCCCCTTGG + Intronic
1171557054 20:26089104-26089126 GTAGTGCGCAGTCACGCCCTAGG - Intergenic
1171869088 20:30511865-30511887 CTGGTGGGCTGCCTCGCCCTGGG - Intergenic
1173075308 20:39812954-39812976 CTTGTAGGCACCCACACCCTTGG + Intergenic
1174352666 20:49979552-49979574 CTTGCAGGCAGCCACTGCCTGGG - Intergenic
1175453996 20:59095910-59095932 CTAGAGGGCAGCCTATCTCTGGG + Intergenic
1184283392 22:43451942-43451964 ATAGTGGACAGCAGCTCCCTAGG - Intronic
1185323126 22:50210995-50211017 CAAGTGCACAGTCACTCCCTGGG + Intronic
949197204 3:1325890-1325912 CTAGTGGAAAGCCAAACCCTTGG + Exonic
950495534 3:13331878-13331900 CTAGGGTGCAGCTTCTCCCTGGG + Intronic
954691353 3:52397251-52397273 CTCCTGGTCAGCCACTCCCTGGG + Intronic
958632280 3:96699780-96699802 CTAGTGGGCAGACACACAGTTGG + Intergenic
959377444 3:105603610-105603632 CTGGTGTGCAGCCACTGCCTTGG - Intergenic
962095143 3:132285401-132285423 CTAGTGGGCAGACACACCAGCGG - Exonic
963283082 3:143405687-143405709 CTAGTGGTCTGCCTCTCCCAGGG + Intronic
970774096 4:19652204-19652226 CTAGAGGCCAGTCACTTCCTTGG + Intergenic
978748639 4:112222832-112222854 CTGGTGGGCAGCTCCGCCCTTGG + Intergenic
983425781 4:167581957-167581979 CTGGTGGGCAGCTCCTCCCACGG + Intergenic
985209055 4:187572529-187572551 TCAGTGGGCAGGCACTCCCTTGG - Intergenic
987091148 5:14508828-14508850 CTAGGTGGCGGCCACTCCCATGG + Exonic
988808592 5:34763506-34763528 CTAGTTGGGAGGTACTCCCTGGG + Intronic
989977460 5:50603070-50603092 GTACCAGGCAGCCACTCCCTAGG + Intergenic
990142896 5:52725943-52725965 CTTGAAGGCAGCCAGTCCCTCGG + Intergenic
994210702 5:97085173-97085195 CTAGTGGGCAGCTCCGCCCTTGG - Intergenic
994592240 5:101788207-101788229 CTGGTAGGCAGGCACACCCTCGG + Intergenic
997643557 5:135465716-135465738 CTAAAGGGCAGCCAGACCCTCGG + Intergenic
998094979 5:139391831-139391853 GAAGTAGGCAGCCACTTCCTGGG + Exonic
1002693274 5:181065789-181065811 CTTCTGGGCAGCCTCTCCCGGGG - Intergenic
1018720748 6:166570075-166570097 ATACTGGACAGCCTCTCCCTTGG - Intronic
1026098271 7:67364496-67364518 CTAGCGGGCAGCTCCTCCCACGG - Intergenic
1026457118 7:70582372-70582394 CCAGTGGGAACCCACTCCGTAGG - Intronic
1026660123 7:72293318-72293340 CTATTGGGCAGCCCCTACCACGG - Intronic
1033576062 7:142686059-142686081 TCAGTGGGGAGCTACTCCCTTGG + Intergenic
1033798679 7:144876463-144876485 ATACTGGGCAGTCACTCCCCTGG - Intergenic
1034990779 7:155546876-155546898 CCACTGGGCAGCCACAGCCTGGG - Intergenic
1035319139 7:158017345-158017367 CCAGTGCCCAGCCCCTCCCTGGG + Intronic
1037787060 8:21909485-21909507 GGACAGGGCAGCCACTCCCTCGG + Exonic
1039943094 8:42108034-42108056 CTGATGGGCAGCCTCTCCATAGG + Intergenic
1042778399 8:72461587-72461609 TTAGAGAGCAGCCACTCCCTGGG + Intergenic
1044494676 8:92862655-92862677 CTTGCAGGCAGCCACTCCATGGG - Intergenic
1047524165 8:125618184-125618206 AAAGTGGGCAGCCTCTCCCTGGG - Intergenic
1047761037 8:127954689-127954711 CTTTGGGGAAGCCACTCCCTGGG - Intergenic
1048306379 8:133287512-133287534 CGAGGGGACAGGCACTCCCTTGG + Intronic
1048949851 8:139487271-139487293 CTCATGGGCAGACATTCCCTTGG - Intergenic
1049276982 8:141724880-141724902 CCTGTAGGCAGCCACTCCCTGGG + Intergenic
1052976049 9:34411047-34411069 CTACAGGCCAGCCACTCCCAGGG - Intronic
1054762600 9:69016346-69016368 TTAGTGGGAAGCCATTCTCTTGG + Intergenic
1057143317 9:92740914-92740936 CTCCTGGGCATGCACTCCCTGGG - Intronic
1057213244 9:93212739-93212761 CTACTGGGCAGCCACACACTGGG - Intronic
1057248620 9:93481059-93481081 CGAATGGCCAGCCACTCCCAGGG - Intronic
1058505626 9:105663001-105663023 CTTGTGGGCCGCCACCCCCCAGG + Exonic
1059964799 9:119603007-119603029 TTTGTTGGCAGCCATTCCCTGGG - Intergenic
1062071918 9:134560371-134560393 CTTGTGGGCAGCCATGGCCTTGG - Intergenic
1062099388 9:134720294-134720316 CTGGTGGGCAGCCCCTGCTTGGG - Intronic
1190834498 X:54087860-54087882 CCTGTGGCCAGCCAGTCCCTTGG - Exonic
1201151010 Y:11095658-11095680 CAAGTGGACAACCAGTCCCTAGG + Intergenic
1201514706 Y:14806961-14806983 TTAATGGTCAGCCACTACCTGGG - Intronic