ID: 1122505583

View in Genome Browser
Species Human (GRCh38)
Location 14:102229824-102229846
Sequence TGCCCACTAGAGTCCCACGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 62}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122505576_1122505583 -1 Left 1122505576 14:102229802-102229824 CCAGACACCCCAAGGGAGTGGCT 0: 1
1: 0
2: 0
3: 6
4: 106
Right 1122505583 14:102229824-102229846 TGCCCACTAGAGTCCCACGGGGG 0: 1
1: 0
2: 0
3: 1
4: 62
1122505575_1122505583 0 Left 1122505575 14:102229801-102229823 CCCAGACACCCCAAGGGAGTGGC 0: 1
1: 0
2: 0
3: 11
4: 137
Right 1122505583 14:102229824-102229846 TGCCCACTAGAGTCCCACGGGGG 0: 1
1: 0
2: 0
3: 1
4: 62
1122505570_1122505583 9 Left 1122505570 14:102229792-102229814 CCACCAGGTCCCAGACACCCCAA 0: 1
1: 0
2: 1
3: 27
4: 282
Right 1122505583 14:102229824-102229846 TGCCCACTAGAGTCCCACGGGGG 0: 1
1: 0
2: 0
3: 1
4: 62
1122505572_1122505583 6 Left 1122505572 14:102229795-102229817 CCAGGTCCCAGACACCCCAAGGG 0: 1
1: 0
2: 1
3: 18
4: 243
Right 1122505583 14:102229824-102229846 TGCCCACTAGAGTCCCACGGGGG 0: 1
1: 0
2: 0
3: 1
4: 62
1122505579_1122505583 -10 Left 1122505579 14:102229811-102229833 CCAAGGGAGTGGCTGCCCACTAG 0: 1
1: 0
2: 1
3: 11
4: 114
Right 1122505583 14:102229824-102229846 TGCCCACTAGAGTCCCACGGGGG 0: 1
1: 0
2: 0
3: 1
4: 62
1122505578_1122505583 -9 Left 1122505578 14:102229810-102229832 CCCAAGGGAGTGGCTGCCCACTA 0: 1
1: 0
2: 1
3: 5
4: 118
Right 1122505583 14:102229824-102229846 TGCCCACTAGAGTCCCACGGGGG 0: 1
1: 0
2: 0
3: 1
4: 62
1122505577_1122505583 -8 Left 1122505577 14:102229809-102229831 CCCCAAGGGAGTGGCTGCCCACT 0: 1
1: 0
2: 1
3: 11
4: 156
Right 1122505583 14:102229824-102229846 TGCCCACTAGAGTCCCACGGGGG 0: 1
1: 0
2: 0
3: 1
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122505583 Original CRISPR TGCCCACTAGAGTCCCACGG GGG Intronic
901877396 1:12174740-12174762 TGCCCACTAGTGTCCAAAAGAGG - Intronic
905933573 1:41806687-41806709 TGCCCACTGGAGTGCCACAGAGG - Intronic
911870020 1:103085456-103085478 TGCCCAGTGAAATCCCACGGAGG + Intronic
920087820 1:203430662-203430684 TCCCCACTGGAGTCACAGGGAGG + Intergenic
1075342198 10:121655930-121655952 ATCCCACTTGAGTCCCCCGGAGG - Intergenic
1075607185 10:123820444-123820466 TGCTCACTAGTGTCCCACTTTGG + Intronic
1076590411 10:131578469-131578491 TGGCCAGTGGACTCCCACGGAGG - Intergenic
1076821872 10:132943484-132943506 CACCCACGAGAGTCCCACGTGGG + Intergenic
1078765414 11:14292215-14292237 TGCCCACTAGAACCCCAAAGAGG - Intronic
1083303018 11:61748608-61748630 AGGCCAGGAGAGTCCCACGGTGG + Intergenic
1083954968 11:65978076-65978098 TGCCCACTAGAGACAAACTGAGG - Intronic
1084786199 11:71443140-71443162 TGCCAAATAGTGTCCCACAGTGG + Intronic
1089338116 11:117739607-117739629 TACCCACTAGAACCCCACAGTGG + Intronic
1090735515 11:129609410-129609432 TGTCCTCTAGAGTCCCTCAGAGG - Intergenic
1099584370 12:84497997-84498019 TGCCCACTAGAGCCCCCTGTTGG + Intergenic
1103250511 12:119496027-119496049 TGTCCACTGGAGTACCACAGTGG - Intronic
1105019795 12:132808409-132808431 TGCGCACCAGTGTCCCTCGGGGG - Exonic
1106504700 13:30360953-30360975 TGCCCACAAGAGACCTAGGGGGG + Intergenic
1112223244 13:97513152-97513174 TGCCCACTGGATTCCCCCAGTGG - Intergenic
1113652235 13:112042172-112042194 TGCCCAGAAGAGTCCCAGAGAGG + Intergenic
1122505583 14:102229824-102229846 TGCCCACTAGAGTCCCACGGGGG + Intronic
1127752622 15:62060584-62060606 GGCCCTCTAGAGGCCGACGGAGG + Intergenic
1134511046 16:14847048-14847070 TATCAAGTAGAGTCCCACGGGGG + Intronic
1134973146 16:18549129-18549151 TATCAAGTAGAGTCCCACGGGGG - Intronic
1143040827 17:4035271-4035293 TGCCCTCTTGAGTCACACTGAGG - Intronic
1143330425 17:6130958-6130980 TGCCTACTATATTCCCATGGAGG + Intergenic
1148241239 17:46000631-46000653 TGCACACTAGAGTCACCCAGGGG - Intronic
1152606214 17:81291898-81291920 TGACCCCTAGTGTGCCACGGTGG - Intronic
1152741132 17:82018935-82018957 TGCACACTATTGTCCCAGGGAGG + Exonic
1158833079 18:61302109-61302131 TGTCCACTAGAGTTGCACTGTGG - Intergenic
1162907354 19:13831627-13831649 TGGGCACTAGGGTCCCAGGGTGG + Exonic
1163827132 19:19530029-19530051 TGCCCACCAGACCACCACGGGGG - Intronic
1164745863 19:30612435-30612457 TGCCCACTTGATTCTCACTGAGG + Intronic
1168492360 19:56821542-56821564 TGCCCCCTAGAGTCCAGCTGGGG - Intronic
927621732 2:24667986-24668008 CCCCCACTAGAGTTCCACGAGGG + Intronic
936503394 2:113084445-113084467 TGCCCTCTAGAGTTACACAGTGG - Intergenic
1169096857 20:2908449-2908471 TGCACACTCAAGTCCCACAGTGG - Intronic
1178537230 21:33420396-33420418 TGGGGACTAGAGTCCCACGTGGG + Intronic
1179374991 21:40842129-40842151 CGCCCACTAGTGTCCTATGGCGG + Intronic
1179394953 21:41030858-41030880 TGCTCAGTAGAATCCCATGGAGG - Intergenic
1184453540 22:44596818-44596840 TGCCCACTGCAGGCCCACAGCGG + Intergenic
1185412165 22:50688500-50688522 TGCCCACTGGGGTCCCAGAGTGG + Intergenic
950477584 3:13223659-13223681 TGCCCACAAGAGACACACTGGGG + Intergenic
953883736 3:46704395-46704417 TGTCCCCTAGAGACCCAGGGTGG + Intronic
954117016 3:48472654-48472676 TGCCCAACAGAGGCCCAAGGAGG + Intronic
969111462 4:4846938-4846960 TCCCCAGGAGAGTCCCAGGGAGG + Intergenic
972701268 4:41496371-41496393 TGCTAGCTAGAGTCCCACTGGGG - Intronic
977132462 4:93258970-93258992 TGCTGACTAGAGTACCACTGAGG + Intronic
985685914 5:1281398-1281420 TGCACACTCGAGTCCCTGGGGGG - Intronic
988676827 5:33441171-33441193 CACCCACTAGAGTCCCAGGCTGG - Intronic
1002102076 5:176862625-176862647 TGCCCAGCAGAGTGCCACCGTGG + Exonic
1005030652 6:21505688-21505710 TGTCCACTAGAATCACATGGAGG + Intergenic
1006116951 6:31780617-31780639 TGCCCACCAGAGGCTCAGGGTGG + Intronic
1006294477 6:33163988-33164010 TGCCCAGCAGAGGCACACGGTGG - Intronic
1023736580 7:43240965-43240987 TGGCCACTTGAGTCCAACAGAGG + Intronic
1037226749 8:16602041-16602063 TGCCCACTAGGGTCTCTGGGTGG - Intergenic
1037456329 8:19067922-19067944 TACCCACAAGGGTCCCACGTTGG - Intronic
1038389260 8:27179976-27179998 TGCCCACTAGATGCCCATGTTGG + Intergenic
1042560890 8:70071446-70071468 TCGCCACTAGGGTCCCAGGGAGG - Intronic
1053052212 9:34971427-34971449 AGCCCTCTACAGTGCCACGGCGG - Exonic
1061928746 9:133821299-133821321 TGCCAACAAGAGACCCACTGCGG - Intronic
1062200684 9:135301183-135301205 TGCCAGCTAGAGTCCCCCTGTGG + Intergenic
1062606193 9:137349923-137349945 TGAGCACTAGAGCCCCCCGGGGG - Intronic
1189847287 X:45149239-45149261 GACCCTCCAGAGTCCCACGGAGG - Exonic