ID: 1122506319

View in Genome Browser
Species Human (GRCh38)
Location 14:102234081-102234103
Sequence TCTGACTGTTAAGCGGCCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 28
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 27}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122506315_1122506319 6 Left 1122506315 14:102234052-102234074 CCTCAATCTGTAAGCTTGGGGCT 0: 1
1: 7
2: 9
3: 12
4: 135
Right 1122506319 14:102234081-102234103 TCTGACTGTTAAGCGGCCGGTGG 0: 1
1: 0
2: 0
3: 0
4: 27
1122506312_1122506319 8 Left 1122506312 14:102234050-102234072 CCCCTCAATCTGTAAGCTTGGGG 0: 1
1: 7
2: 7
3: 12
4: 109
Right 1122506319 14:102234081-102234103 TCTGACTGTTAAGCGGCCGGTGG 0: 1
1: 0
2: 0
3: 0
4: 27
1122506309_1122506319 18 Left 1122506309 14:102234040-102234062 CCAATATAAACCCCTCAATCTGT 0: 1
1: 11
2: 21
3: 29
4: 122
Right 1122506319 14:102234081-102234103 TCTGACTGTTAAGCGGCCGGTGG 0: 1
1: 0
2: 0
3: 0
4: 27
1122506314_1122506319 7 Left 1122506314 14:102234051-102234073 CCCTCAATCTGTAAGCTTGGGGC 0: 1
1: 7
2: 7
3: 12
4: 98
Right 1122506319 14:102234081-102234103 TCTGACTGTTAAGCGGCCGGTGG 0: 1
1: 0
2: 0
3: 0
4: 27
1122506305_1122506319 25 Left 1122506305 14:102234033-102234055 CCCTTCCCCAATATAAACCCCTC 0: 1
1: 7
2: 11
3: 23
4: 202
Right 1122506319 14:102234081-102234103 TCTGACTGTTAAGCGGCCGGTGG 0: 1
1: 0
2: 0
3: 0
4: 27
1122506306_1122506319 24 Left 1122506306 14:102234034-102234056 CCTTCCCCAATATAAACCCCTCA 0: 9
1: 10
2: 5
3: 24
4: 230
Right 1122506319 14:102234081-102234103 TCTGACTGTTAAGCGGCCGGTGG 0: 1
1: 0
2: 0
3: 0
4: 27
1122506307_1122506319 20 Left 1122506307 14:102234038-102234060 CCCCAATATAAACCCCTCAATCT 0: 1
1: 9
2: 12
3: 31
4: 198
Right 1122506319 14:102234081-102234103 TCTGACTGTTAAGCGGCCGGTGG 0: 1
1: 0
2: 0
3: 0
4: 27
1122506308_1122506319 19 Left 1122506308 14:102234039-102234061 CCCAATATAAACCCCTCAATCTG 0: 1
1: 10
2: 8
3: 33
4: 141
Right 1122506319 14:102234081-102234103 TCTGACTGTTAAGCGGCCGGTGG 0: 1
1: 0
2: 0
3: 0
4: 27

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122506319 Original CRISPR TCTGACTGTTAAGCGGCCGG TGG Intronic
912926067 1:113914368-113914390 TCTGACTTCTAGGCGGCCGAAGG + Intergenic
1063467403 10:6256090-6256112 TCAGACTGTGATGGGGCCGGGGG - Intergenic
1064298482 10:14100505-14100527 TCAGACTTTTAAGGGGTCGGGGG - Intronic
1075948674 10:126459025-126459047 TCTGAGTGGTAAGCTGCAGGTGG - Exonic
1079311800 11:19373146-19373168 TCTGAATGTTAAGTGCCCTGGGG + Intronic
1088820464 11:113452263-113452285 TCTGACAGCCAAGGGGCCGGTGG + Intronic
1090084412 11:123638792-123638814 TCTGTCTTTTGAGCTGCCGGTGG + Intronic
1105009225 12:132744363-132744385 TCTGGCTGTGAAGTGTCCGGTGG + Intronic
1112807264 13:103176519-103176541 TCTGACTCTTAACCAGCTGGTGG - Intergenic
1113272304 13:108686782-108686804 TCTGGATGTTCAGCGGCCTGAGG + Intronic
1122506319 14:102234081-102234103 TCTGACTGTTAAGCGGCCGGTGG + Intronic
1133324254 16:4933924-4933946 TGTGAATGATAAGCGGCCGCAGG - Intronic
1133383982 16:5354077-5354099 TCTCACAGGTAAGGGGCCGGTGG - Intergenic
1139717269 16:68823518-68823540 TGTGACTGTGAAGGGGCCGCTGG + Exonic
1151835697 17:76581396-76581418 TCTGACTGTTCTGGGGTCGGGGG + Intronic
1153466832 18:5397351-5397373 TCTCAGTGCTAAGCGGCAGGTGG + Exonic
1157206890 18:45708307-45708329 TCTGGCTTTTAAGAGGCTGGTGG + Intergenic
1159246113 18:65807640-65807662 ACTGAGCGTTAAGCGGCCCGGGG + Intronic
940004235 2:148996854-148996876 TGTGACTGTTAGGTGGCCTGTGG - Intronic
945785603 2:214232570-214232592 TCTGACTGTGAAGGAGTCGGGGG + Intronic
1170067148 20:12324883-12324905 TCTGACTGAGGAGCGGCCTGAGG + Intergenic
1184407639 22:44308960-44308982 TCTGGGTGTGAAGCGGCTGGTGG + Intronic
979988564 4:127345649-127345671 TCTGACTGTAAAGAGGCATGAGG - Intergenic
984762030 4:183370848-183370870 TCTGAAAGTTATGCGGCTGGGGG + Intergenic
1038693399 8:29783202-29783224 TCTGACTGTTAAGCACCCCATGG - Intergenic
1051034674 9:12729461-12729483 GCTGACTGTCAAGAGCCCGGAGG + Intergenic
1061964537 9:134005438-134005460 TCAGACTTTTGAGCGGCTGGGGG + Intergenic
1188391212 X:29622638-29622660 TCTAACTGTTAAGAGGCCATAGG - Intronic