ID: 1122506320

View in Genome Browser
Species Human (GRCh38)
Location 14:102234085-102234107
Sequence ACTGTTAAGCGGCCGGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 35}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122506306_1122506320 28 Left 1122506306 14:102234034-102234056 CCTTCCCCAATATAAACCCCTCA 0: 9
1: 10
2: 5
3: 24
4: 230
Right 1122506320 14:102234085-102234107 ACTGTTAAGCGGCCGGTGGCAGG 0: 1
1: 0
2: 0
3: 1
4: 35
1122506315_1122506320 10 Left 1122506315 14:102234052-102234074 CCTCAATCTGTAAGCTTGGGGCT 0: 1
1: 7
2: 9
3: 12
4: 135
Right 1122506320 14:102234085-102234107 ACTGTTAAGCGGCCGGTGGCAGG 0: 1
1: 0
2: 0
3: 1
4: 35
1122506308_1122506320 23 Left 1122506308 14:102234039-102234061 CCCAATATAAACCCCTCAATCTG 0: 1
1: 10
2: 8
3: 33
4: 141
Right 1122506320 14:102234085-102234107 ACTGTTAAGCGGCCGGTGGCAGG 0: 1
1: 0
2: 0
3: 1
4: 35
1122506305_1122506320 29 Left 1122506305 14:102234033-102234055 CCCTTCCCCAATATAAACCCCTC 0: 1
1: 7
2: 11
3: 23
4: 202
Right 1122506320 14:102234085-102234107 ACTGTTAAGCGGCCGGTGGCAGG 0: 1
1: 0
2: 0
3: 1
4: 35
1122506307_1122506320 24 Left 1122506307 14:102234038-102234060 CCCCAATATAAACCCCTCAATCT 0: 1
1: 9
2: 12
3: 31
4: 198
Right 1122506320 14:102234085-102234107 ACTGTTAAGCGGCCGGTGGCAGG 0: 1
1: 0
2: 0
3: 1
4: 35
1122506312_1122506320 12 Left 1122506312 14:102234050-102234072 CCCCTCAATCTGTAAGCTTGGGG 0: 1
1: 7
2: 7
3: 12
4: 109
Right 1122506320 14:102234085-102234107 ACTGTTAAGCGGCCGGTGGCAGG 0: 1
1: 0
2: 0
3: 1
4: 35
1122506309_1122506320 22 Left 1122506309 14:102234040-102234062 CCAATATAAACCCCTCAATCTGT 0: 1
1: 11
2: 21
3: 29
4: 122
Right 1122506320 14:102234085-102234107 ACTGTTAAGCGGCCGGTGGCAGG 0: 1
1: 0
2: 0
3: 1
4: 35
1122506314_1122506320 11 Left 1122506314 14:102234051-102234073 CCCTCAATCTGTAAGCTTGGGGC 0: 1
1: 7
2: 7
3: 12
4: 98
Right 1122506320 14:102234085-102234107 ACTGTTAAGCGGCCGGTGGCAGG 0: 1
1: 0
2: 0
3: 1
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122506320 Original CRISPR ACTGTTAAGCGGCCGGTGGC AGG Intronic
917552695 1:176051598-176051620 ACTGTAAAGCAGCCGCAGGCAGG + Intronic
921268450 1:213445797-213445819 ACTGCTAAGTGGCCGGTTTCTGG + Intergenic
1072552142 10:96487219-96487241 TCTGTTAAGCAGCCAGTGCCAGG + Intronic
1073582651 10:104682065-104682087 ACTGTGAAGGGGCTGGTGGGGGG + Intronic
1075970853 10:126650890-126650912 CCTGTGAAGTGGCAGGTGGCTGG - Intronic
1077168915 11:1157802-1157824 GCTGGCCAGCGGCCGGTGGCAGG - Intergenic
1078125016 11:8552791-8552813 ACTGTTAAGCAGCCTCAGGCAGG - Intronic
1084606427 11:70175015-70175037 ACTGTGATGTGGCAGGTGGCGGG - Intronic
1086251278 11:84817592-84817614 ACTCATAAGCTGCAGGTGGCTGG - Intronic
1096542255 12:52314447-52314469 ACTGGAAAGGGGCCTGTGGCTGG - Exonic
1103323267 12:120103753-120103775 ACAGTTGAGCGACCGGTGCCTGG - Intronic
1119089060 14:71763393-71763415 ACTGTTACCCAGCCAGTGGCAGG - Intergenic
1119180607 14:72602544-72602566 ACTGTGAGTCGGCCGGTGGAGGG - Intergenic
1122506320 14:102234085-102234107 ACTGTTAAGCGGCCGGTGGCAGG + Intronic
1130153595 15:81331182-81331204 CCTTTTAAGCAGTCGGTGGCCGG + Intergenic
1131534290 15:93221690-93221712 CCTTTTAAGCAGTCGGTGGCTGG + Intergenic
1133233579 16:4377609-4377631 ACTGTGGAGGGGACGGTGGCAGG - Intronic
1146895058 17:36534936-36534958 ACTGCTAAGTGGCCGGGGGTCGG + Exonic
1149261251 17:54882250-54882272 ACTGTTAAACAGCCTCTGGCAGG + Intergenic
1150429166 17:65101671-65101693 ACTGTTAAGCTGCCCTTGGGTGG - Intergenic
1161218014 19:3104425-3104447 ACTGTGGGGCGGCCTGTGGCAGG + Intronic
1168650455 19:58089005-58089027 ACTGTTAAGAGGCTGGGGGCCGG + Intronic
926735345 2:16069655-16069677 ACAGATAAGGGGGCGGTGGCGGG - Intergenic
930873234 2:56187398-56187420 ACTTTTCAGGGGCCTGTGGCCGG + Intronic
932766320 2:74472749-74472771 CCTGCTAAGCAGCCGGCGGCCGG - Exonic
1183578607 22:38708570-38708592 CCTGTTAAGCAGCAGGAGGCAGG + Intronic
969686274 4:8676074-8676096 ACTGTTGAGCGGCCAGGGCCAGG - Intergenic
981484071 4:145266483-145266505 ACAGTTAAAAGGCAGGTGGCAGG + Intergenic
1003573492 6:7271289-7271311 ACTGTTAAGAGGCAGGAGGATGG + Intronic
1004141770 6:13024698-13024720 ACTATTAAGCAGCCTGTGGTCGG + Intronic
1011242817 6:85290060-85290082 CCTGTTGAGGGGTCGGTGGCTGG + Intergenic
1011995514 6:93582015-93582037 TCTTTTAAGTGGGCGGTGGCAGG + Intergenic
1018222597 6:161595981-161596003 CCTGTGGAGTGGCCGGTGGCAGG + Intronic
1018856475 6:167678775-167678797 CCTGGAAAGCGGCCGGGGGCGGG - Intergenic
1041330962 8:56724559-56724581 AGTGTTTAGGGGGCGGTGGCAGG - Intergenic
1061271077 9:129543067-129543089 ACTGTGATGCTGGCGGTGGCAGG - Intergenic
1187518024 X:19990552-19990574 TCTGTTAAGAGGGCGGGGGCCGG - Intergenic