ID: 1122507957

View in Genome Browser
Species Human (GRCh38)
Location 14:102243956-102243978
Sequence TAGTTCCTTTGCAAGAGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 438
Summary {0: 4, 1: 79, 2: 143, 3: 71, 4: 141}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122507957 Original CRISPR TAGTTCCTTTGCAAGAGTGA GGG (reversed) Intronic
900275217 1:1821612-1821634 TAGTTCCTTTGCACGAGACAGGG - Intronic
900722231 1:4184611-4184633 TAGTCTTTTTGCAAGAGTGAGGG + Intergenic
900841068 1:5048976-5048998 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
902051193 1:13564834-13564856 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
902970088 1:20042118-20042140 TAGTCCTTTTGCAAGAGTGAGGG + Intronic
903395702 1:23000378-23000400 TAGTCTTTTTGCAAGAGTGAGGG + Intergenic
904394231 1:30207362-30207384 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
905060204 1:35133690-35133712 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
905429565 1:37911621-37911643 TAGTCCTTTTGCAAGAATGAGGG - Intronic
906379026 1:45319825-45319847 CAGTCCTTTTGCAAGAATGAGGG - Intergenic
906791053 1:48659124-48659146 GAATTCCTGTGGAAGAGTGAAGG + Intronic
908391037 1:63683814-63683836 TAGTTCCTCTGTAAGACTGGAGG - Intergenic
909015020 1:70371525-70371547 TAGTCTCTTTGCAAGAGTGAGGG - Intronic
909729772 1:78876794-78876816 TAGTCCCTTTGCAAGGGTGAGGG - Intergenic
910002497 1:82356743-82356765 TAGTCTCTTTGCAAGAGTGAGGG + Intergenic
910049669 1:82959462-82959484 TAGCCCTTTTGCAAGAGTGAGGG - Intergenic
911071458 1:93835107-93835129 TAGTCCCTTTGCAAGCATGAGGG - Intronic
911147687 1:94568451-94568473 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
911931681 1:103912494-103912516 AAGTTCCAGTGCAACAGTGATGG - Intergenic
911984147 1:104600282-104600304 TAGTCCCTTTGCAAAAATGAGGG - Intergenic
911988208 1:104658552-104658574 TTGTTCCTTTGCAGGAGATATGG + Intergenic
912296999 1:108479722-108479744 TAGTTCCTTTTTAAGAGTAATGG + Intergenic
912815033 1:112822196-112822218 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
912939173 1:114029979-114030001 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
913095440 1:115511767-115511789 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
913245470 1:116866607-116866629 TAGTTCCTTTGCAAGAGTGAGGG - Intergenic
916329079 1:163594686-163594708 TAGTCCTTTTGCAGGACTGACGG - Intergenic
917021437 1:170592817-170592839 AAGTTTGTTTGCATGAGTGAAGG + Intergenic
917749950 1:178044092-178044114 TAATTCCTTTGCAAGAGTGAGGG - Intergenic
918974475 1:191464305-191464327 TAGTTCCATTGCAAGAGGAATGG - Intergenic
919476677 1:198038856-198038878 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
920425698 1:205873312-205873334 AAATTCCTTTGCAAGAGTGAGGG - Intergenic
920427031 1:205886680-205886702 AAATTCCTTTGCAAGAGTGAGGG + Intergenic
920908334 1:210191613-210191635 TAATTCCTTTGCAAGAGTGAGGG - Intergenic
922363254 1:224842032-224842054 TAGTCCTTTTGTAAGAGCGAGGG + Intergenic
922845128 1:228678682-228678704 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
922935100 1:229416500-229416522 TAGTCTTTTTGCAAGAGTGAGGG - Intergenic
923213908 1:231831787-231831809 TCGTCCTTTTGCAAGAGTGAGGG + Intronic
924895899 1:248337817-248337839 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1062957623 10:1550775-1550797 TAGTCATTTGGCAAGAGTGAAGG + Intronic
1065437938 10:25720790-25720812 TATTCTTTTTGCAAGAGTGAGGG - Intergenic
1066103115 10:32135405-32135427 TAGTCCCTTTGCAAGAGTGATGG + Intergenic
1066436865 10:35403716-35403738 TGGTCTCTTTGCAAGAGTGAGGG + Intronic
1067360628 10:45574878-45574900 TAGTCCTTTTGGAAGAGTGAGGG - Intronic
1068701325 10:60023239-60023261 AAGTTCCATGGCAAGGGTGAAGG + Intergenic
1069169632 10:65210107-65210129 TAGTTGCTTGGCAAGAGAGGAGG - Intergenic
1069521015 10:69121545-69121567 TTGTTCTTTTGCAAGAGACAAGG + Intergenic
1070893747 10:79964138-79964160 TAGTCCTTTTGCAAGAGTGAGGG - Intronic
1071063991 10:81609317-81609339 AAGTAATTTTGCAAGAGTGAGGG + Intergenic
1071187550 10:83061430-83061452 TAGTCCTTTGGCAAGAGTGAGGG - Intergenic
1071740173 10:88349289-88349311 AAGTTGCTTTGCAAGTGAGAGGG + Intronic
1071822027 10:89288793-89288815 TGGTACTTTTGCAAGAGTGAGGG - Intronic
1072011049 10:91303327-91303349 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1072884768 10:99263333-99263355 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1073014347 10:100386027-100386049 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
1073130628 10:101186810-101186832 TAGTCCTTTTGCAAGAGTGAAGG + Intergenic
1073395016 10:103210395-103210417 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
1073683792 10:105731345-105731367 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
1075014222 10:118898344-118898366 TAATTCCTTTGCAAGAGTGAGGG - Intergenic
1075305563 10:121364747-121364769 TAGCCCCTCTGCCAGAGTGATGG + Intergenic
1078789336 11:14526959-14526981 TAGTCCCTTTGCAAAGGTGAGGG - Intronic
1079230835 11:18647379-18647401 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1079835713 11:25329805-25329827 TAGTCCCTTTGCAAGATTGAGGG + Intergenic
1079847363 11:25488598-25488620 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1080994224 11:37580620-37580642 TAGTCCCTTTGCATGTGTGAAGG + Intergenic
1081160049 11:39738902-39738924 TAGTCCCTTTGCAAGGGTGAGGG - Intergenic
1082197467 11:49323024-49323046 TAGTCGCTTTGCAAGAGTGAGGG + Intergenic
1084354533 11:68628642-68628664 TAGTCTTTTTGCAAGAGTGAGGG - Intergenic
1085988316 11:81810542-81810564 TAATCTTTTTGCAAGAGTGAGGG - Intergenic
1086133372 11:83422771-83422793 CAGTCCTTTTGGAAGAGTGAGGG - Intergenic
1086134518 11:83433001-83433023 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1086135964 11:83444290-83444312 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1086550523 11:88047515-88047537 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1086658353 11:89385103-89385125 TAGTCACTTTGCAAGAGTGAGGG - Intronic
1087150045 11:94851078-94851100 TAGTTTCTATGCAAGACTTATGG - Intronic
1087167752 11:95021872-95021894 TAATTCCTTTGCAAGAGTGAGGG + Intergenic
1087197198 11:95313637-95313659 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1088986967 11:114917696-114917718 TAATTCCTTTGAAATAATGAAGG + Intergenic
1089866760 11:121639509-121639531 TAGCCTTTTTGCAAGAGTGAGGG + Intergenic
1089953653 11:122551454-122551476 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1093358773 12:18199450-18199472 TAGTCCTTTTACAAGAGTGAGGG - Intronic
1094400990 12:30060314-30060336 TAGTTCTTTTGCAAGAGTGAGGG - Intergenic
1094826069 12:34270060-34270082 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1095637918 12:44453911-44453933 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1095644248 12:44524103-44524125 TGGTTTCTTTGTAAGAGAGATGG - Intronic
1095806445 12:46325318-46325340 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
1096906978 12:54944989-54945011 TACTCCTTTTGCAAGAGTGAGGG + Intergenic
1097541877 12:60953357-60953379 CAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1098920230 12:76295951-76295973 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
1098977666 12:76920221-76920243 TAGGTAGTATGCAAGAGTGAGGG - Intergenic
1100293790 12:93241874-93241896 TACTTCCTGTTGAAGAGTGAAGG - Intergenic
1100940626 12:99719616-99719638 TAGTGCTTTTGCAAGAGTGAGGG - Intronic
1102012456 12:109627034-109627056 TAGTTCCTTTTCAGGATGGATGG + Intergenic
1102116461 12:110406881-110406903 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
1102604828 12:114060336-114060358 TAATTCCTTTGCAAGAGTGAGGG - Intergenic
1103513014 12:121488149-121488171 TAATTTCTTTGCAATAGTTATGG - Intronic
1104257932 12:127156071-127156093 CAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1105032611 12:132894517-132894539 TAGTCCTTTTGCAAGAGTGAGGG - Intronic
1108281741 13:48868487-48868509 CAATTCCTTTGCAAGAGTGAGGG + Intergenic
1108702991 13:52959523-52959545 ATGTCCCTTTGCAAGAGTGAGGG + Intergenic
1108803587 13:54129270-54129292 TAGTCGTTTTGCAAGAGTGAGGG + Intergenic
1109353223 13:61209132-61209154 TAGTCTTTTTGCAAGAGTGAGGG - Intergenic
1110238873 13:73244927-73244949 TGGTTCCCTTGCCACAGTGATGG - Intergenic
1110845629 13:80187806-80187828 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
1110978761 13:81870306-81870328 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1111872690 13:93853303-93853325 TGGTTCCTTTGCCATAGTGGTGG - Intronic
1112889054 13:104209690-104209712 TAGTCTTTTTGCAAGAGTGAGGG + Intergenic
1114222011 14:20705063-20705085 TAGTTCCTTTGCAAGAATGAGGG - Intergenic
1114300885 14:21376642-21376664 TAGTCCCTTTGTATGAGTCAAGG + Intronic
1116490304 14:45496965-45496987 TAGTGTTTTTGCAAGAGTGAGGG + Intergenic
1117174469 14:53132568-53132590 CAGTTCTTTTGCAAGAGTGAGGG - Intronic
1119559993 14:75582342-75582364 TAGTCCCTTCGCAAGAGTGAGGG + Intronic
1120150395 14:81026414-81026436 TAATTCCTTTTCAATAATGAAGG - Intronic
1120539283 14:85734556-85734578 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1120760646 14:88281592-88281614 TAGTTCCAGTGCAAGTCTGAAGG - Intronic
1121192970 14:92046149-92046171 TAGTCCTTTTGCAAGAGCGAGGG + Exonic
1121389692 14:93563499-93563521 TAGTCCCTTTGCAATAGTGAGGG + Intronic
1121980318 14:98448858-98448880 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
1122507957 14:102243956-102243978 TAGTTCCTTTGCAAGAGTGAGGG - Intronic
1123882260 15:24687465-24687487 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1124173301 15:27397542-27397564 TACTTCCTCTGCCAGATTGAGGG + Intronic
1125849367 15:42888602-42888624 TAGTCCCTTTGCAAGAGTGAGGG - Intronic
1126128797 15:45320736-45320758 TAGTTCCTTGGTATGAGTCATGG - Intergenic
1126844084 15:52743079-52743101 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1128817031 15:70617882-70617904 TATTTTCTTTGCAAGATGGAAGG + Intergenic
1129259694 15:74357963-74357985 TAATTCATTTGCAAGGGTTAGGG - Intronic
1129557990 15:76533682-76533704 TATTTACTGAGCAAGAGTGAAGG - Intronic
1130304827 15:82706290-82706312 TAGTCCTTTTGCAAGACTGAGGG - Intronic
1133492081 16:6280109-6280131 CAGTTCCATTGCAAGATTCAGGG - Intronic
1133939038 16:10293135-10293157 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1135025125 16:18993801-18993823 TAGTCCCTTTGCAAGAGAGAGGG + Intronic
1136346185 16:29677654-29677676 AAGTTCCTTGGAAAGAGGGAAGG + Intronic
1136530251 16:30863327-30863349 TAGTCCCCTTGCAAGAGTGAGGG - Intronic
1137055024 16:35741231-35741253 AAGTCCTTTTGCAAGAGTGGGGG + Intergenic
1137363753 16:47842896-47842918 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
1137896361 16:52217000-52217022 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1138758810 16:59519223-59519245 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1140643144 16:77000662-77000684 TAGTTCCAGTCCAAGCGTGAGGG - Intergenic
1141414507 16:83859873-83859895 TAGTTCCATTGCAAAATAGAGGG - Intergenic
1143414027 17:6733008-6733030 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
1145080392 17:19890202-19890224 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
1145113865 17:20189951-20189973 TGGTTCATTTGCATGAGTGTAGG + Intronic
1148198487 17:45731899-45731921 TAGTTCCTTGGTATGAGTTATGG + Intergenic
1150095370 17:62369908-62369930 TGGTTCCTGTGTTAGAGTGATGG + Intergenic
1151503056 17:74504694-74504716 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
1152413625 17:80144852-80144874 TAGTTGCTTTGCAAGAGAGATGG - Intronic
1152454277 17:80404083-80404105 TACTCCTTCTGCAAGAGTGAGGG - Intergenic
1152662658 17:81550131-81550153 TTGTTCTTTTGCAAGGCTGACGG - Intronic
1152901177 17:82941892-82941914 TTGTTACTTTAGAAGAGTGACGG - Intronic
1154468658 18:14675143-14675165 TACTTCATTTGCAATAATGACGG + Intergenic
1155941831 18:31807927-31807949 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1155962277 18:32004576-32004598 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
1156302571 18:35848253-35848275 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1156916113 18:42465742-42465764 TAGTCCCTTTTCAAGAGTGACGG - Intergenic
1156923830 18:42554494-42554516 TAATCCTTTTGCAAGAGTGAGGG + Intergenic
1158576517 18:58643297-58643319 TAGTCCCTTTGTAAGAGTGAGGG + Intergenic
1159929447 18:74296105-74296127 CAGTCCCTTTGCAAGAGTGAGGG - Intergenic
1162262573 19:9544740-9544762 TATTCCCTTTGCAAGAGTGAAGG - Intergenic
1163343107 19:16722591-16722613 TAATTCTTTTTTAAGAGTGAGGG - Intronic
1163899871 19:20091828-20091850 TAGTCCTTTTGCAAGAGTGAGGG + Intronic
1163944175 19:20520705-20520727 TAGTCCCTTTGCAAGATTGAGGG + Intergenic
1164003694 19:21130611-21130633 CAGTACCTTTGCAAGAGTGAGGG + Intergenic
1164081133 19:21862292-21862314 TAGTCCCTTTGTAAGAATGAGGG - Intergenic
1164153259 19:22572366-22572388 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1164220341 19:23187594-23187616 CAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1164259079 19:23553546-23553568 TAGTCCCTTTGCAAGAATGAGGG - Intronic
1164639587 19:29813990-29814012 TAGTTCATCTGGAAGCGTGAAGG + Intronic
1165249470 19:34517652-34517674 AAGTCTCTTTGCAAGAGTGAGGG - Intergenic
1166905443 19:46105271-46105293 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1167901454 19:52625226-52625248 TAGTCCCTTTGCAAGAGTGAGGG - Intronic
1168211843 19:54896479-54896501 TAGTCCTTTTGCATCAGTGAGGG + Intergenic
1168248538 19:55127145-55127167 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
925433554 2:3817403-3817425 CAGTCCCTTTGCAAGAGTGAGGG + Intronic
927134431 2:20086345-20086367 TGGTCCTTTTGCAAGAGTGAGGG - Intergenic
928878643 2:36071510-36071532 CAGATCCCTTGCAAGAGTAACGG + Intergenic
929383886 2:41382438-41382460 TAGTCCATTTGCAAGAGTGAGGG - Intergenic
930098716 2:47586855-47586877 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
930706410 2:54508998-54509020 TAGTCCCTTTGCAAGAGTGAGGG + Intronic
933179502 2:79213428-79213450 TAGTCCTTTTGCAAGAGTGAGGG + Intronic
936794013 2:116185847-116185869 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
936870953 2:117133612-117133634 TAGTCCCTTTGCAGGAGTGAGGG - Intergenic
937594690 2:123659542-123659564 CAGTCCTTTTGCAGGAGTGAAGG + Intergenic
939094853 2:137822691-137822713 TAGTCCTTTCGCAAGAGCGAGGG - Intergenic
939307690 2:140430264-140430286 TAGTCCTTTTGCGAGAGTGAGGG - Intronic
939460461 2:142491430-142491452 TAGTCCCATTGCAAGAGTGAGGG + Intergenic
939742311 2:145924017-145924039 TAATTCCTTTGCCAGAATTATGG + Intergenic
939824635 2:146999541-146999563 TAGGGCCTTGGCAAGGGTGATGG - Intergenic
940184041 2:150962808-150962830 TAATTCCTTTGCAAGAATGAGGG - Intergenic
940508545 2:154585118-154585140 TAGTCCTTTTGTAAGAGTGAGGG + Intergenic
941455856 2:165711706-165711728 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
941721156 2:168814521-168814543 TAGTTTCTTTTGAAGAGTAATGG - Intronic
941750900 2:169134671-169134693 TAGTCCCTTTGCAAGAGTGAGGG - Intronic
943412646 2:187562069-187562091 TAGTCCTTTTGCAATAGTGAAGG + Intronic
943447384 2:188004720-188004742 TTCTTCCTTTTCAAGAGTGTTGG + Intergenic
943460909 2:188170788-188170810 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
944251371 2:197582609-197582631 TTGTCCCTTTGCAAGAGTGAGGG - Intronic
944387732 2:199183499-199183521 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
944685324 2:202112804-202112826 TAGTTACTTAGAAAGATTGAAGG - Intronic
945286274 2:208085796-208085818 CAGTTTCTTTGCAAAAGTGCAGG - Intergenic
945332312 2:208553882-208553904 TAGCTGCTTTGCAAGAGAGTTGG + Intronic
945361918 2:208903355-208903377 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
945376387 2:209082198-209082220 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
945554984 2:211265567-211265589 TAGTCCCTTTACAAGAGTGAGGG - Intergenic
945634641 2:212332498-212332520 TATTTGATTTGCAAGAGTGAAGG - Intronic
946871444 2:224089228-224089250 TAGTACCTTTGCAAGAGTGAGGG + Intergenic
947598806 2:231431843-231431865 CAGTCCCTTTGCAAGACTGAGGG + Intergenic
947842509 2:233217217-233217239 TAGTCCCTTTGCAAGAGTGAGGG + Intronic
1168942995 20:1729343-1729365 TACTCCTTTTGCAAGAGTGAGGG + Intergenic
1169673294 20:8128605-8128627 TTGTTCCTTGGAAAGAGAGAGGG + Intergenic
1170680125 20:18518973-18518995 TAATTCCTTTGCAAGAGTGAGGG + Intronic
1173397323 20:42691585-42691607 CAGTTCCTTTGCATAAGGGAGGG - Intronic
1173652383 20:44674864-44674886 TAGTTCCTTTGCAAGAGTGAGGG - Intergenic
1174258121 20:49274086-49274108 TAATTCCTTTAGTAGAGTGATGG + Intronic
1176175646 20:63722446-63722468 TAGTTGCTTTGCTGGAGAGACGG + Intronic
1178669552 21:34578730-34578752 GAGTGCCTTTCCAAGAGTGCAGG + Intronic
1180579340 22:16815635-16815657 TATTTACTTTTTAAGAGTGAAGG + Intronic
1183635318 22:39058666-39058688 TAGTCCCTTTGCAAGAGTGAGGG + Intronic
1184227920 22:43140986-43141008 TGATTCCTTTTCAAGACTGAAGG - Intronic
1184627580 22:45749090-45749112 TAGTTAGTTTGCAATAGTAATGG - Intronic
1184761615 22:46547904-46547926 TGGTTCCTTTGCATGATTCAGGG + Intergenic
949124905 3:435367-435389 TATGTCCTTTTTAAGAGTGAGGG - Intergenic
949186452 3:1197904-1197926 TTGTTTCTTTGCATGAGTTAGGG - Intronic
949473444 3:4419988-4420010 GAGTTCTTTTGCAAGAGCAAAGG + Intronic
951027441 3:17844779-17844801 TAGTTACTTGGCAAAAGTGATGG + Intronic
951279491 3:20731283-20731305 TTGTTCCTGTGGAAAAGTGAAGG - Intergenic
951762472 3:26161754-26161776 TTGTCCTTTTGCAAGAGTGAGGG + Intergenic
951894896 3:27601259-27601281 TAATTCCTTTGCAAGAGTGAGGG - Intergenic
952297214 3:32072079-32072101 TAATTCCTTTGCAAGAGTGAGGG - Intronic
952343299 3:32463044-32463066 TAGTCCTTTTGCAGGAGTGAGGG + Intronic
952894881 3:38071873-38071895 TAGTCCTTTTCCAAGAGTGAGGG + Intronic
953656221 3:44856890-44856912 TAGTCCTTTTGCAAGAGTGAGGG + Intronic
953834152 3:46328700-46328722 CAATCCTTTTGCAAGAGTGAGGG + Intergenic
954161445 3:48725692-48725714 TAGTCCTTTTGCAAGAGTGAGGG + Intronic
956233237 3:67040367-67040389 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
956622386 3:71234416-71234438 CAGTTCTTTTGCAAGGGTGAAGG - Intronic
957451727 3:80388990-80389012 TAGTCCCGTTGCAAGAGTGAGGG - Intergenic
957675039 3:83355199-83355221 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
957734609 3:84189540-84189562 TAATTCCTTTGCAAGAGTGAGGG + Intergenic
957759386 3:84535186-84535208 TAGTTTCTTTGTCAGGGTGAGGG - Intergenic
957904520 3:86539589-86539611 TAGTTCATTTGCAAGAGTGAGGG + Intergenic
958422280 3:93942252-93942274 TAGTCCCTTTGCAAGAGTGAGGG - Intronic
958676514 3:97274561-97274583 TAGTCCTTTTGCAAGAGTGAGGG + Intronic
958948350 3:100390280-100390302 TAGTTCTTTTGCGAGATTGACGG - Intronic
961990671 3:131186791-131186813 TATTTCCATTGCAAAAGTCATGG - Intronic
962021933 3:131510981-131511003 TAATCCCTTTGCAAGAGTGAGGG + Intergenic
962523645 3:136219318-136219340 TAATTCCTTTGCAAGAGTGAGGG + Intergenic
963111587 3:141693204-141693226 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
963193297 3:142497851-142497873 TAGTTTTTTTCTAAGAGTGATGG + Intronic
963320082 3:143801790-143801812 TAATCCCTTTGCAAGAGTGAGGG - Intronic
964125175 3:153228266-153228288 TAGTCCTTTTGCAGGAGTGAGGG + Intergenic
964153073 3:153551314-153551336 TTATTCATTTGCACGAGTGAGGG - Intergenic
964299943 3:155276553-155276575 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
964940643 3:162155512-162155534 TAATTCCTTTGCAAGAGTGAGGG + Intergenic
965070630 3:163911867-163911889 TAGTCCTTTGGCAAGATTGAGGG - Intergenic
965335439 3:167427097-167427119 TAGTCCCTTTGCAAGAGTAAGGG - Intergenic
965434683 3:168634798-168634820 TATTTCCTTTTCAACAGTCATGG + Intergenic
965861674 3:173157338-173157360 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
966067144 3:175832014-175832036 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
966148539 3:176840291-176840313 TATTTCCATTTAAAGAGTGAAGG + Intergenic
966279618 3:178211864-178211886 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
966398146 3:179522521-179522543 TACTCCTTTTGCAAGAGTGAGGG + Intergenic
966965054 3:184983068-184983090 AAGATTCTTTGCAAGATTGATGG - Exonic
968412934 4:404950-404972 TAATTCCTTGGCAAGAGTGAGGG + Intergenic
968476862 4:814725-814747 GAGTCCCTGTGCCAGAGTGATGG + Intronic
970256136 4:14172107-14172129 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
970533012 4:17001792-17001814 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
970853773 4:20631880-20631902 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
971179512 4:24315941-24315963 TAGTTCCTATCCAAGAGTTTTGG + Intergenic
971329879 4:25673611-25673633 CATTTCCTTTACAAGAGTGAAGG - Intronic
971541970 4:27830035-27830057 TTGTGTCTTGGCAAGAGTGATGG + Intergenic
973337079 4:48967569-48967591 TAGTTCCTTTGCAAGGTGAATGG + Intergenic
973751395 4:54023767-54023789 TAGTCCTTTTGCAAGAGTGAGGG - Intronic
974173137 4:58292909-58292931 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
974382806 4:61163023-61163045 TATTTCCTTTGGAAGTGTGAGGG + Intergenic
974904114 4:68035111-68035133 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
975246100 4:72122005-72122027 TTGTTTCTTTGCAAGTGAGATGG - Intronic
976719279 4:88154415-88154437 TAGTCCCTTTGCAAGAGCAAGGG + Intronic
976739617 4:88344968-88344990 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
977225061 4:94385054-94385076 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
977782173 4:100993456-100993478 AAGTCCTTTTGCAAGAGTGAAGG + Intergenic
978471912 4:109077445-109077467 TTGTTCCTTAGCAGGAGTGTTGG - Intronic
980003087 4:127513057-127513079 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
980302381 4:131011341-131011363 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
980928251 4:139159932-139159954 TAGTCCCTTTGCAAGAGTGAGGG + Intronic
981482622 4:145254401-145254423 TAGTCTCTTTGCAAGAGTGAGGG + Intergenic
982319143 4:154060775-154060797 CAGTCATTTTGCAAGAGTGAGGG - Intergenic
982396448 4:154920438-154920460 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
983056343 4:163102456-163102478 TACTCCTTTTGCAAGAGTGAGGG + Intergenic
983883445 4:172957746-172957768 TAGTCCTTTTGCAAGAGTGAGGG + Intronic
984322464 4:178211211-178211233 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
984437576 4:179724776-179724798 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
985078717 4:186243738-186243760 TAGTCCCTTTGCAAGAGTGAGGG + Intronic
985429163 4:189861551-189861573 TAGTTTGTTTGGAAGAGAGAGGG - Intergenic
986368637 5:7059521-7059543 TAGTCCTTTTGTAAGAGTGAGGG + Intergenic
988199409 5:28049980-28050002 TAATTCCTTTGCAAGAGTGAGGG - Intergenic
989614850 5:43329374-43329396 TAGTCCCTTTGCAGGAGTGAAGG + Intergenic
989660169 5:43789906-43789928 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
989688587 5:44115940-44115962 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
990564856 5:57018734-57018756 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
992451724 5:76882056-76882078 TAGTCCCTTTGCAAGAGTGAGGG + Intronic
994125820 5:96168471-96168493 TAATTCCTTTGCAAGAGTGAGGG + Intergenic
994295423 5:98083194-98083216 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
994375490 5:99012944-99012966 TAATTCCTTTGCAAGAGTGAGGG + Intergenic
994778673 5:104065783-104065805 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
995801016 5:115995054-115995076 TAAATCCTTTGAATGAGTGAAGG - Intronic
996574750 5:124968496-124968518 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
996723152 5:126649210-126649232 CAGTCCTTTTGCAAGGGTGAGGG - Intergenic
996725497 5:126670360-126670382 TAGTCCCTTTGCAAGAATGAGGG + Intergenic
996917946 5:128733458-128733480 TAGTCTCTTTGCAAGAGTGAAGG - Intronic
997678520 5:135733108-135733130 TAGTCCTTTTGCAAGGGCGAGGG + Intergenic
1000438839 5:161244095-161244117 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1000440023 5:161252827-161252849 TAGTCTTTTTGCAAGAGTGAGGG - Intergenic
1000607212 5:163337974-163337996 CAGTCTTTTTGCAAGAGTGAGGG - Intergenic
1001230997 5:169988293-169988315 TAAAGCCTTTGCAACAGTGATGG - Intronic
1001353964 5:171002601-171002623 TAGTCCCTTTGCAAGAGTGAAGG + Intronic
1001462327 5:171927317-171927339 TAGTTCCTTTGAAAGAATTGAGG - Intronic
1003100089 6:3170362-3170384 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
1003925734 6:10876208-10876230 TAGTTCTTTTAATAGAGTGAAGG - Intronic
1004113824 6:12748237-12748259 TAGTTACTATGCACGTGTGAAGG + Intronic
1004401007 6:15288708-15288730 TTGATCCTTTGCAAAAATGAGGG + Intronic
1006325112 6:33347776-33347798 TAGTCCCTTTGCAAAAGTGAGGG - Intergenic
1007084418 6:39133333-39133355 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
1007300646 6:40865481-40865503 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
1007931058 6:45690950-45690972 TTGTTCCCTTGCAAGAGTCCTGG - Intergenic
1008452111 6:51664732-51664754 TAGTTCCTTTGCAATCAGGAAGG - Intronic
1009270084 6:61604074-61604096 TAGTCCTTTTGCAAGAGCAAGGG - Intergenic
1009379405 6:63009297-63009319 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1009464662 6:63954380-63954402 TCGTCCCTTTGCAAGAGTGAGGG - Intronic
1009749975 6:67870248-67870270 TAGTACCTTTGCAAGAGTGAGGG + Intergenic
1010423134 6:75696788-75696810 TAATTCCTCTCCAATAGTGATGG + Intronic
1010586413 6:77662137-77662159 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1010829423 6:80511900-80511922 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1010841067 6:80649650-80649672 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1012675374 6:102106075-102106097 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1012910959 6:105117579-105117601 AAATCCCTTTGCCAGAGTGAGGG + Intronic
1013807766 6:114013701-114013723 TAATCCCTTTGCAAGAGGGAGGG + Intergenic
1014115011 6:117660925-117660947 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
1014612305 6:123560298-123560320 TAGCCCCTTTGTAAGAGTGAGGG - Intronic
1015606902 6:134967025-134967047 TAGTTCCTTAGCAGGAGTTCAGG + Intronic
1015801073 6:137062705-137062727 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1015870158 6:137768131-137768153 CAGTTCCTTTGCAACAGCAAAGG - Intergenic
1016751221 6:147632378-147632400 TAGTCCTTTTGCAAGAGTGAGGG + Intronic
1017201263 6:151757098-151757120 GAGTTCCTTTGCATTAGTGAGGG + Intronic
1017270129 6:152494601-152494623 TAGTCCCTTTGCAAGAGTGAGGG - Intronic
1017922539 6:158884777-158884799 TAATTCCTTTGCAAGAGTGAGGG + Intronic
1018077878 6:160232441-160232463 TAGTCCCTTTGCAAGAGTGAGGG - Intronic
1018136042 6:160779251-160779273 TAGTCCCTTTGCAAGAGCGAGGG - Intergenic
1018373795 6:163192226-163192248 AGGTTCCTTTGCAAGAATGTTGG - Intronic
1019186847 6:170225461-170225483 TGGTACCTTGGCAAGAGTGCTGG - Intergenic
1020540821 7:9459922-9459944 TAGTTGTTTTGTAAGAGTGAGGG + Intergenic
1020794507 7:12663786-12663808 TAGTCCTTTTGCAAGAGAGAGGG - Intergenic
1021172995 7:17418212-17418234 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1021329079 7:19312590-19312612 TAATGACATTGCAAGAGTGAGGG + Intergenic
1021430129 7:20549565-20549587 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1021660871 7:22916849-22916871 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1022447698 7:30483346-30483368 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1022515556 7:30972775-30972797 TAGATCCTCTGCAAGTGTGCTGG + Intronic
1024738940 7:52335077-52335099 CAGTCCTTTTGCAAGAGTAAGGG + Intergenic
1027158657 7:75786427-75786449 TAGTCCCTTTGCAAGAGTGAGGG - Intronic
1027354637 7:77343350-77343372 TAGTCCTTTTGCAAGATTGAGGG - Intronic
1028397582 7:90388735-90388757 TATTTGCTTTGCAAGGATGAAGG + Exonic
1028589559 7:92480991-92481013 TAGTCCCTTTGCAAGAGTGAAGG + Intergenic
1030163295 7:106529803-106529825 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
1030445577 7:109644217-109644239 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1030925375 7:115446812-115446834 TATTTCTTTAGCATGAGTGAGGG - Intergenic
1031354918 7:120778725-120778747 TAGTGCTTTTGCAAGAGTGAGGG + Intergenic
1031777651 7:125921909-125921931 TTGTCCTTTCGCAAGAGTGAGGG - Intergenic
1033084982 7:138332992-138333014 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
1033088867 7:138366860-138366882 TAATTCCTTTGCAAAAGTGAGGG - Intergenic
1033211778 7:139465221-139465243 TAGTCCTTTTGCAAGAGCAAGGG - Intronic
1033464726 7:141580199-141580221 TAGTCCTTTTGCAAGAGTGAGGG + Intronic
1033625841 7:143108784-143108806 TAGTCCCTTTGCAAGAGTGAAGG - Intergenic
1034477199 7:151292261-151292283 TTGTTCCTGTCCAATAGTGATGG - Intergenic
1034963567 7:155377650-155377672 TCCTTCCTTTGCAACCGTGAAGG - Intergenic
1035058847 7:156054200-156054222 TTCTTCCTTTGAAACAGTGAAGG - Intergenic
1036472055 8:9061025-9061047 TAGTCCTTTTGCAAGAGCGAGGG + Intronic
1036549990 8:9807209-9807231 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1037388243 8:18365515-18365537 TTGCTCCTTTCCAAGACTGAGGG - Intergenic
1039445801 8:37630894-37630916 TAGTCCCTCTGCAAGAGGGTTGG + Intergenic
1040648319 8:49423864-49423886 TAGTCCCTTTGCAAGAGTGAAGG - Intergenic
1041497285 8:58500573-58500595 TAGGTGCTTTGCCAGAGAGACGG + Intergenic
1041651528 8:60307869-60307891 TAGTCCCTTTGAAAGAGTGAGGG + Intergenic
1041917214 8:63149700-63149722 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1042706398 8:71668651-71668673 TCATCCCTTTGCAAGAGTGAGGG - Intergenic
1043479825 8:80641544-80641566 AAAATCCCTTGCAAGAGTGAGGG + Intronic
1043599168 8:81917785-81917807 TAATTCTTTTGCAAGAGTGAGGG - Intergenic
1043717635 8:83506803-83506825 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1043838005 8:85067053-85067075 TAGTCCTTTTGTAAGAGTGAGGG - Intergenic
1045533099 8:103002750-103002772 TAGTCCTTTTACAAGAGTGAGGG - Intergenic
1045853588 8:106734675-106734697 TAGTCCATTTGTAATAGTGATGG + Intronic
1046075146 8:109304535-109304557 TAGTGCCTTTGCAAGAGTGAGGG - Intronic
1047601897 8:126433857-126433879 TAGTTCCTTGACATGAGTCATGG - Intergenic
1049818588 8:144620659-144620681 TGCATCCCTTGCAAGAGTGATGG + Intergenic
1050896312 9:10888597-10888619 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1052152391 9:25133116-25133138 TACTTCCTTTGGAAGATTGGAGG - Intergenic
1052163385 9:25292015-25292037 TAGTCTTTTCGCAAGAGTGAGGG - Intergenic
1052938646 9:34114446-34114468 TCATTCCTTTGCAATAATGAGGG - Intronic
1053059704 9:35021390-35021412 TAGTCCCTTTGCAAGGGTGAGGG + Intergenic
1055122518 9:72678236-72678258 GAGTTTCTTTGCTAGAATGAAGG + Intronic
1055882007 9:81013136-81013158 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1056324170 9:85462773-85462795 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
1057042412 9:91857278-91857300 TGGTTCCTGTGCAAAAGGGAAGG - Intronic
1058025914 9:100142276-100142298 TAGTCCTTTTGCAAGAGTGAGGG + Intronic
1059540722 9:115127746-115127768 TCTTTCCATCGCAAGAGTGACGG - Intergenic
1059782279 9:117542571-117542593 TTATTACTTTGCCAGAGTGAAGG + Intergenic
1062692303 9:137848607-137848629 TAATTCCTTTGCAAAAGTGAGGG - Intronic
1187103489 X:16218567-16218589 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
1188332726 X:28894203-28894225 TAGTACCTTTGCAAGAGTGCGGG + Intronic
1189386558 X:40541515-40541537 TAATCCCTATGCAAGAGTGTTGG - Intergenic
1190125931 X:47705454-47705476 TAGTGCCTTTAGGAGAGTGAGGG + Intergenic
1190577642 X:51856942-51856964 TAAAACCTTTGCAAGAGTTATGG - Intronic
1191013915 X:55790076-55790098 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
1191761623 X:64653402-64653424 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1191825892 X:65364235-65364257 TAGTTCCTTTGCAAGAGTGAGGG - Intergenic
1192425130 X:71068379-71068401 TAGTTATTTTGCAAGCGGGAGGG - Intronic
1192454955 X:71268760-71268782 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
1192706439 X:73531802-73531824 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
1192764185 X:74125696-74125718 TAGTCCCTTTGCAAGGGTGTGGG + Intergenic
1192913826 X:75633729-75633751 CAATCCTTTTGCAAGAGTGAGGG + Intergenic
1193537393 X:82731172-82731194 TAGTCCTTTTGCAAGAGTCAGGG - Intergenic
1194660999 X:96628367-96628389 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1194873482 X:99160828-99160850 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1195016779 X:100788855-100788877 TAGTCCCTTTGCAAGAGTGAGGG + Intergenic
1195231226 X:102850696-102850718 TAGTTCCTATTCAAAACTGAAGG + Intergenic
1195290883 X:103431224-103431246 TAGTCCTTTTGCAAGAGCGAGGG + Intergenic
1195326588 X:103763454-103763476 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic
1196497102 X:116334652-116334674 TAGTCCTTTTGCAAGAGTGAGGG - Intergenic
1197500029 X:127230922-127230944 TAGTCCTTTTACAAGAGTGAGGG - Intergenic
1198591104 X:138183203-138183225 TAGTTCCTTTTTGAGAATGAAGG + Intergenic
1198966238 X:142230894-142230916 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
1200813150 Y:7505070-7505092 TAGTCCCTTTGCAAGAGTGAGGG - Intergenic
1201061418 Y:10050059-10050081 TAGTCACCTTGCAAGAGTGAGGG + Intergenic
1201307210 Y:12561331-12561353 TAGTCCCTTTGCAAGAATGAGGG + Intergenic
1201724552 Y:17138414-17138436 TAGTCCCTTTGCAAGAGGGAGGG + Intergenic
1201937449 Y:19423470-19423492 TAGTCCTTTTGAAAGAGTGAGGG - Intergenic
1202042351 Y:20698414-20698436 GAGCTCCTTTGCAAGCCTGAAGG - Intergenic
1202062304 Y:20900207-20900229 TAGTCCCTTTGAAAGAGTGAGGG - Intergenic
1202076209 Y:21040299-21040321 TAGTCCTTTTGCAAGAGTGAGGG + Intergenic