ID: 1122511575

View in Genome Browser
Species Human (GRCh38)
Location 14:102272727-102272749
Sequence CTCAGCAAGCTATTCATGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 168}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122511574_1122511575 -4 Left 1122511574 14:102272708-102272730 CCAATTCAGGACAAAAATTCTCA 0: 1
1: 4
2: 26
3: 139
4: 622
Right 1122511575 14:102272727-102272749 CTCAGCAAGCTATTCATGAAAGG 0: 1
1: 0
2: 0
3: 15
4: 168
1122511572_1122511575 24 Left 1122511572 14:102272680-102272702 CCAAAAAGTCATTTGACAGAATT 0: 1
1: 0
2: 10
3: 116
4: 608
Right 1122511575 14:102272727-102272749 CTCAGCAAGCTATTCATGAAAGG 0: 1
1: 0
2: 0
3: 15
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122511575 Original CRISPR CTCAGCAAGCTATTCATGAA AGG Intronic
902127742 1:14230993-14231015 CACAGCAAGGAACTCATGAAGGG - Intergenic
903309251 1:22440644-22440666 CTCAACAAGCTAGGAATGAAAGG - Intergenic
905456910 1:38094678-38094700 CTCAGCAGCTTATTAATGAAGGG - Intergenic
908728088 1:67198143-67198165 GGCAGCAAGCCATTCATGAAGGG + Intronic
910077174 1:83295374-83295396 ATAAGCAACCTATTCATGTATGG + Intergenic
910865511 1:91784744-91784766 CTCAGGAATCTATACATCAAGGG + Intronic
915060641 1:153180913-153180935 CTGAACAGGCAATTCATGAAAGG - Intergenic
915068643 1:153246943-153246965 CTCAGCAATCTCTTCCTGGAAGG + Intergenic
918225854 1:182482249-182482271 TGCAGCAAGCTTTTCATAAATGG - Intronic
918867270 1:189918719-189918741 CTCAACAAACTAGTCATCAAAGG - Intergenic
919184279 1:194124346-194124368 CAAAGAAAGCAATTCATGAAGGG + Intergenic
919714384 1:200760296-200760318 GTCAGCAAGCTAAGCATGAAGGG + Intronic
920657255 1:207886225-207886247 CTCAGAAGGGTGTTCATGAAGGG + Intronic
921527530 1:216236229-216236251 ATCAGCAAGCTGCTCAAGAAGGG - Intronic
924192069 1:241564189-241564211 CTCTGTAAGCTATACATGGAAGG + Intronic
924567502 1:245210794-245210816 CTCAGCCAGCTAGTCCTGCAGGG + Intronic
924901943 1:248410585-248410607 AGCACCAAGCCATTCATGAAGGG - Intergenic
1068587840 10:58819878-58819900 CTCAGCAAACTATCACTGAAAGG - Intronic
1069068237 10:63968243-63968265 CTCAGCAAACTAGGCATCAAAGG + Intergenic
1070525446 10:77292323-77292345 CTCAGCAAGCAATTGTTGGATGG - Intronic
1071314795 10:84384590-84384612 CTCAGCAAACTAGGCATCAAAGG + Intronic
1071890565 10:90001911-90001933 ATCAGCAAGGCAGTCATGAATGG + Intergenic
1074623308 10:115149510-115149532 CTCAACAAACTAAGCATGAAAGG - Intronic
1075159653 10:120011987-120012009 CTGAGGGAGCTATTAATGAATGG - Intergenic
1075554596 10:123421302-123421324 CTCAGCAAACTCTTCCTTAAAGG - Intergenic
1078360412 11:10663469-10663491 CTCAACAAGCTTTTCTAGAATGG - Intronic
1080343971 11:31300306-31300328 CCCAGCCAGCTATTCTAGAAAGG + Intronic
1082065667 11:47898064-47898086 CTCAGCAAGCTAGGAATAAAGGG + Intergenic
1083483711 11:62968137-62968159 CTCAGCAAACTAGGCATAAAGGG + Intronic
1084979437 11:72821543-72821565 CTCAGCTTGCTTTTCAGGAAGGG + Intronic
1085541952 11:77279255-77279277 CTCATCAGGCTACTCAGGAAGGG + Intronic
1087395592 11:97592980-97593002 CTCAGCAAAATAGTCATAAAAGG + Intergenic
1088147009 11:106693118-106693140 CTCACCAAGCGATACTTGAAGGG + Intronic
1088162995 11:106896283-106896305 CTCAGTAAACTAGTAATGAAGGG + Intronic
1088180814 11:107107773-107107795 CTCAACAAGCTAGCCATAAAAGG + Intergenic
1088508107 11:110546222-110546244 CTCAACAAGCTATGCATTAAAGG + Intergenic
1090490238 11:127154336-127154358 GTCAGCAAACTTTTCATAAAGGG + Intergenic
1091323998 11:134670638-134670660 TCCAGCAAGCTCTTCGTGAAGGG - Intergenic
1092346546 12:7719901-7719923 CTCAGCAGGAAATACATGAAAGG - Intergenic
1093336254 12:17908234-17908256 CTCAACAAACTATGCATCAATGG - Intergenic
1098548250 12:71734282-71734304 CTCAGCAAGCTATGAATAGAAGG - Intergenic
1101215688 12:102579762-102579784 CTCAGCAAACTATTATTGCAAGG + Intergenic
1106962705 13:35018891-35018913 CTCAACCAGATATTCATAAAAGG - Intronic
1108988569 13:56626484-56626506 CTCAGCAAACTAGGCATGAAAGG + Intergenic
1109450598 13:62509113-62509135 CTCAACAAGCTAGCCATCAAAGG - Intergenic
1113040892 13:106102690-106102712 ATCAGCCAGCTATGCAGGAAGGG + Intergenic
1113481002 13:110621002-110621024 CACAGGAAGCTCTTCAAGAAAGG + Intronic
1116107970 14:40536152-40536174 CTCAACAAACTAGTCATTAAAGG + Intergenic
1117894798 14:60472665-60472687 CTCAGCAAACTATTATTGCAAGG - Intronic
1120330698 14:83089833-83089855 CTAAGCAAAATATTTATGAATGG + Intergenic
1120571229 14:86118936-86118958 CTCAACAAGCTAGTCATTGAAGG - Intergenic
1122260024 14:100511773-100511795 CTCAGCAAACTATGAATAAAAGG - Intronic
1122511575 14:102272727-102272749 CTCAGCAAGCTATTCATGAAAGG + Intronic
1123098807 14:105780576-105780598 CTCAGCAAGTTAGGTATGAAAGG - Intergenic
1124433387 15:29626824-29626846 CTCAGCAAACTAGGTATGAAGGG - Intergenic
1124704125 15:31947194-31947216 CTCAGCAAACTAGGCATCAAAGG + Intergenic
1126300998 15:47195991-47196013 CACAGCAAGTTATCAATGAAGGG + Intronic
1131913478 15:97234925-97234947 CTCAGCAAGGTGTTCATGATTGG + Intergenic
1134233862 16:12450500-12450522 CACAGCAAGCGGTTCAGGAATGG - Intronic
1137267631 16:46882253-46882275 CCCAGCGAGCTACACATGAATGG + Intergenic
1138586996 16:57976973-57976995 CTCAGAAAGATTTTCAGGAAGGG - Intronic
1138755473 16:59479079-59479101 CACATCAAGCTAATCAAGAATGG + Intergenic
1139784202 16:69378072-69378094 CTCAGCAAACTAGGAATGAAGGG - Intronic
1142944951 17:3418298-3418320 CTCAGCCAGTTTTTCATGAGAGG + Intergenic
1144266788 17:13577264-13577286 CTCAGCATGCTATTAATTCATGG + Intronic
1144434377 17:15226769-15226791 CTCAGCAGACTAGTGATGAAGGG - Intergenic
1147445841 17:40474876-40474898 CTCAGCAAGCGATGCAAGAGAGG - Intergenic
1149649506 17:58268121-58268143 CTGAGCAAGCTGTTCATCCAGGG - Exonic
1150597651 17:66620567-66620589 CTCAGAAATCTATTCATAAGGGG + Intronic
1152213044 17:79013396-79013418 CTCTGCAAGGTTTTGATGAATGG + Intergenic
1152943005 17:83182230-83182252 CTCAGCAAGCCCTTCCTGGAGGG - Intergenic
1155216928 18:23651556-23651578 CTCTGCTAGCTTTTCCTGAAAGG + Intronic
1157654710 18:49373557-49373579 ATCAGCAAGGTCTTCATGACTGG + Intronic
1158403494 18:57141283-57141305 CTCAGGAAGCTTTTCCGGAAGGG - Intergenic
1160748501 19:722742-722764 CTGAGCTGGCTATTCAGGAAGGG + Intronic
1162451802 19:10759538-10759560 CTCAGGAAGGTATGCATGGAAGG - Intronic
1163576714 19:18115196-18115218 CTCAGCCAGCCTTTCATGGAAGG + Intronic
1166401924 19:42488057-42488079 ATAAGAAAGCTTTTCATGAACGG + Intergenic
925296649 2:2781399-2781421 CCCAGGAAGCTTTTCCTGAATGG + Intergenic
931205266 2:60140303-60140325 GTCAGGAAACTATTCCTGAAGGG + Intergenic
932626668 2:73301997-73302019 CTCAACAAGATATTCAGGGAAGG + Intergenic
932797253 2:74707294-74707316 GTCAGCAACCTATTCTTAAATGG + Intergenic
932916491 2:75864896-75864918 CTCAGCTAGCATTTGATGAATGG + Intergenic
932978942 2:76639572-76639594 CTCAACAGGCTACTTATGAAGGG + Intergenic
937618259 2:123952991-123953013 CTCAGCAAACTAGGCATAAAAGG + Intergenic
940739630 2:157492638-157492660 CTCAGCAAGATATTCCAGGAAGG - Intergenic
943616906 2:190103159-190103181 CTCAGCAAACTACCCATGAAAGG + Intronic
944198990 2:197085492-197085514 ATCAGCAAGGTCTTCATGACCGG - Intronic
945291853 2:208134823-208134845 CTCAGCAAGCCCTTCCTGAAGGG + Intergenic
946778424 2:223168319-223168341 CTCAGCAAACTTTTTATTAAAGG - Intronic
1177294473 21:19156842-19156864 CTCAACAAACTATGCATCAAAGG - Intergenic
1177671057 21:24228328-24228350 CTCAGCAAGTTATTTTTAAAAGG - Intergenic
1181428860 22:22864640-22864662 AGCAGCAAGCCAATCATGAAGGG + Intronic
1182025547 22:27115493-27115515 CTCAGTAACCTATGCATCAAAGG - Intergenic
1183598949 22:38828927-38828949 CTCAGCAAGCTTCTCTAGAACGG + Intronic
1184537487 22:45097164-45097186 TTCATGAAGATATTCATGAATGG + Intergenic
949182148 3:1145101-1145123 CTTAGCAAACTGTCCATGAAGGG + Intronic
949232002 3:1761096-1761118 CTCAACAATCTAGGCATGAAAGG + Intergenic
949773930 3:7610255-7610277 CTCAGCAGACAATTCATGAGTGG - Intronic
951047435 3:18056151-18056173 CTCAGCAAACTAGGCATCAAAGG - Intronic
951436530 3:22671187-22671209 CTCAGCAATCTCTTCATTCATGG - Intergenic
955140014 3:56259783-56259805 CTCAGCAAGCTAGGCCTGACTGG + Intronic
960036034 3:113104159-113104181 CTCAGCAAGGAATACATTAATGG - Intergenic
961335466 3:126175665-126175687 TTCAGCAAGCTAGTAATAAATGG + Intronic
962035381 3:131645945-131645967 CTCAAGAAACTATGCATGAAAGG + Intronic
962391228 3:134974535-134974557 CACAGCACGCTATGCATGCAAGG - Intronic
964120103 3:153174295-153174317 CTCAGCAAGCCTGTCAAGAAGGG + Intergenic
965154058 3:165023689-165023711 CTCAGCTCGCTATTCATCCATGG - Exonic
965477865 3:169179732-169179754 AGAAGCAAGGTATTCATGAAGGG - Intronic
966276151 3:178172534-178172556 CTCAGCATCCAATTCATGGAAGG - Intergenic
966296778 3:178432830-178432852 CTCTGCAAGCTATACAAGCATGG - Intronic
966577316 3:181517028-181517050 CTCAACAAGCTAGGCATCAAAGG - Intergenic
967198086 3:187046750-187046772 GTCAGCAAGCTTTTCTTAAAAGG + Intronic
970691583 4:18626477-18626499 CTCAGGATGATATTCATGGAAGG + Intergenic
970719976 4:18975303-18975325 CTCTGCAGTCTATTCATAAATGG - Intergenic
971531029 4:27689127-27689149 CTCAGCAAACTAGGCATCAAAGG - Intergenic
974510432 4:62833745-62833767 CTCTGCAAGCTCTCCAAGAATGG + Intergenic
974590879 4:63946723-63946745 CTCAGCAAGCTAGGCATTGAAGG - Intergenic
976411675 4:84720537-84720559 AACACCAAGCCATTCATGAAGGG - Intronic
978263440 4:106792097-106792119 CTCAACAAGCTAAGCATCAAGGG - Intergenic
978452583 4:108851126-108851148 CTCACCAAGATATTATTGAATGG + Intronic
981354403 4:143770944-143770966 CTCAACAAACTATGCATCAAAGG - Intergenic
982282589 4:153700180-153700202 CACACCAAGCCATTCATGAGGGG + Intergenic
982344117 4:154337517-154337539 CATACCAAGCTATTCATAAATGG + Intronic
982562687 4:156949518-156949540 CTCAGGAAATTATTAATGAAGGG + Intronic
982861484 4:160456266-160456288 CTCAGCAAACTAAGAATGAAGGG - Intergenic
983332272 4:166345682-166345704 CTCACCAATTTATTCATTAAAGG - Intergenic
983611748 4:169653883-169653905 GGCACCAAGCCATTCATGAAGGG + Intronic
985916271 5:2921257-2921279 CTCAGCCAGCCATCCAGGAATGG - Intergenic
986122458 5:4854148-4854170 CACAGAAATCTAGTCATGAATGG - Intergenic
988186177 5:27865875-27865897 CTCAGCAAACTAGGCATCAAAGG + Intergenic
990831085 5:59958661-59958683 CTCAGCAAACTAGGCATCAAAGG + Intronic
990969503 5:61488046-61488068 CTCAGCAAACTAGGCATAAAAGG - Intronic
992634742 5:78716731-78716753 CTCAGCATAGTATTCATGAAGGG + Intronic
993642859 5:90426910-90426932 TTCACCAAACTATTCAGGAAGGG - Intergenic
997021813 5:130011442-130011464 CTCAGCAAACTAGTCATCAATGG + Intronic
997228138 5:132224857-132224879 CTAAGCAAGCACTTCCTGAAAGG + Intronic
1000196453 5:158963715-158963737 CCCATCCAGCTATTAATGAATGG + Intronic
1000882464 5:166714016-166714038 CGCATCAAGCCATTCATGAGGGG + Intergenic
1002658664 5:180774295-180774317 GGCAGCAAGACATTCATGAAGGG + Intergenic
1004171186 6:13296673-13296695 ATCAGCTAGCTATGCATGAGCGG + Intronic
1004910937 6:20283003-20283025 CTCAACAAACTAGTCATCAAAGG + Intergenic
1007853109 6:44824366-44824388 CTCACCCAGCTATTTCTGAATGG - Intronic
1008779739 6:55089127-55089149 GTCACCAAGCCATTCATGAAGGG + Intergenic
1009729738 6:67585126-67585148 CTCAACAAGCTAGACATGAAAGG - Intergenic
1011360813 6:86522744-86522766 CTTAACAGGCTATTCATTAAAGG - Intergenic
1011562578 6:88636436-88636458 CTCAGGCAGCTAGTCATGGAAGG + Intronic
1012902753 6:105026295-105026317 CAGAGCAAACTATTCATGGAAGG + Exonic
1013168123 6:107611967-107611989 CTGGGCAAGATATTCATGAAAGG - Intronic
1013605534 6:111744073-111744095 CTTCTCCAGCTATTCATGAAGGG - Intronic
1017472134 6:154749480-154749502 CTCAGCAAGCTCTTTCTGATGGG + Intronic
1020601967 7:10286872-10286894 CTCAGCAAACTTTGAATGAAAGG - Intergenic
1021617122 7:22513538-22513560 CTCAGCAAACTAATAATGGAAGG - Intronic
1022245828 7:28558402-28558424 GTCAGGTAGCTCTTCATGAATGG - Intronic
1022926716 7:35062990-35063012 CTCAGCAAACTAATAATGGAAGG - Intergenic
1024326805 7:48115205-48115227 GGCACCAAGCTATTCATGAGGGG + Intergenic
1026399752 7:69997729-69997751 AACACCAAGCCATTCATGAAGGG + Intronic
1026421922 7:70247909-70247931 CTCAGCAAACTAGAAATGAAGGG - Intronic
1028375554 7:90142561-90142583 CTCAGCAAACTAATAATGGAAGG + Intergenic
1031568917 7:123333938-123333960 CTCAGCAAACTATCCATAGAAGG + Intergenic
1036002355 8:4621994-4622016 CTCAGCAAACTACTAATGATAGG + Intronic
1038514037 8:28169163-28169185 CCCAGCAATTTATTCATGAATGG - Intronic
1042150166 8:65773401-65773423 CTCATCATGCTGTTCATAAAAGG - Intronic
1044735355 8:95273116-95273138 CTCAGCATGCTTTCCATGACTGG - Intergenic
1046594187 8:116241049-116241071 CTCCACAAGCTGTACATGAAAGG + Intergenic
1047627003 8:126666747-126666769 AGCACCAAGCTATTCATGAAGGG + Intergenic
1049517107 8:143066003-143066025 CACAGCAAGGTAGTCAGGAATGG - Intergenic
1049724941 8:144141506-144141528 CTCAGAATGCAATTCAGGAAAGG - Intergenic
1058799632 9:108532701-108532723 CACATGAAGCCATTCATGAAAGG - Intergenic
1059053817 9:110957555-110957577 CTCAGCAAACTAGGCATAAAAGG + Intronic
1059556386 9:115284852-115284874 CCCAGCAAGCTATTGCTAAAGGG - Intronic
1203368201 Un_KI270442v1:276661-276683 CTCAGCAAAATATTCATGACTGG - Intergenic
1185793353 X:2944539-2944561 CTCAACAAGCTAGGCATGGAAGG - Intronic
1187600083 X:20819427-20819449 CTCAACAAACTAGTCATCAAAGG + Intergenic
1188848879 X:35107715-35107737 CTCTACAAACTATTCATTAAAGG + Intergenic
1189364628 X:40379028-40379050 CACAGCAATCTATTCTGGAAGGG - Intergenic
1190794598 X:53729238-53729260 GGCACCAAGCCATTCATGAAGGG + Intergenic
1191202689 X:57801819-57801841 CTCAACAAGCTAGGCATCAAAGG + Intergenic
1192768236 X:74164300-74164322 CTCAACAAGCTAGGCATCAAAGG + Intergenic
1193283008 X:79677549-79677571 CTGACCAAGCTGTTCCTGAATGG + Intergenic
1198581290 X:138067596-138067618 CTCAGCAAGTAATTCCTAAAGGG - Intergenic
1199099008 X:143776465-143776487 CTCAACAAACTAGGCATGAAAGG - Intergenic
1200365573 X:155658857-155658879 CTCAACAAGCTAGGCATCAAAGG - Intronic
1200789742 Y:7288709-7288731 ATCAGCAAGCTCTTTATGACCGG + Intergenic