ID: 1122519528

View in Genome Browser
Species Human (GRCh38)
Location 14:102333764-102333786
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 304}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122519528_1122519535 14 Left 1122519528 14:102333764-102333786 CCACCTGGCTGTCCTGTGAACCC 0: 1
1: 0
2: 0
3: 32
4: 304
Right 1122519535 14:102333801-102333823 TCTGAGCAGAGCCCACAAGCTGG 0: 1
1: 0
2: 0
3: 21
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122519528 Original CRISPR GGGTTCACAGGACAGCCAGG TGG (reversed) Intronic