ID: 1122519528

View in Genome Browser
Species Human (GRCh38)
Location 14:102333764-102333786
Sequence GGGTTCACAGGACAGCCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 304}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122519528_1122519535 14 Left 1122519528 14:102333764-102333786 CCACCTGGCTGTCCTGTGAACCC 0: 1
1: 0
2: 0
3: 32
4: 304
Right 1122519535 14:102333801-102333823 TCTGAGCAGAGCCCACAAGCTGG 0: 1
1: 0
2: 0
3: 21
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122519528 Original CRISPR GGGTTCACAGGACAGCCAGG TGG (reversed) Intronic
900357965 1:2273812-2273834 CGGTCCACAGAACAGACAGGAGG - Intronic
900409234 1:2505313-2505335 GGGGACACAGGGCAGCCAGGGGG - Exonic
900418061 1:2544051-2544073 GCGTGCAGGGGACAGCCAGGAGG - Intergenic
900951937 1:5863134-5863156 AAGTGCACAGGTCAGCCAGGTGG + Exonic
901126234 1:6930711-6930733 GGGTTCAGGGGACAGCCAAATGG - Intronic
901923585 1:12552538-12552560 GGGCTGACAGGGCAGCCTGGTGG - Intergenic
902449630 1:16488677-16488699 GGGAGCCCATGACAGCCAGGGGG - Intergenic
902728993 1:18356459-18356481 GTATTCACAGGAGATCCAGGTGG - Intronic
903121606 1:21219980-21220002 GGGTTCATGGGTGAGCCAGGTGG + Exonic
903373357 1:22850862-22850884 GTGTTCTCAGGGCAGCCAAGAGG + Intronic
904429599 1:30453474-30453496 GGGTGCACAGGATAGGGAGGAGG + Intergenic
904529007 1:31155594-31155616 GGGTTCTCAGGACAGACGTGTGG - Intergenic
905252439 1:36658380-36658402 GGGTTCAGCAGACAGCCAGATGG - Intergenic
905456678 1:38092808-38092830 GGGTGCCCAGCACAGCTAGGAGG + Intergenic
905690705 1:39940734-39940756 GGCCTCAGAGGACAGCGAGGGGG - Intergenic
906066471 1:42984687-42984709 GGGGACACAGCACAGGCAGGTGG + Intergenic
907053291 1:51344203-51344225 GTGTTCATAGGACAGTCAGATGG + Intronic
908008936 1:59755826-59755848 GGGGCCAAAGCACAGCCAGGAGG + Intronic
911340320 1:96628284-96628306 GGGTACTCAGGAAAGCCAGTGGG + Intergenic
914247684 1:145897924-145897946 GGGTTGAGAGGAAAGCAAGGAGG + Intronic
914899548 1:151704477-151704499 GAGTGCACAGGACAGACTGGGGG - Intronic
915689554 1:157675378-157675400 GGTTTCACAGGACAGGCCCGGGG + Intronic
915692143 1:157700302-157700324 GGGTTCCCTGGACAACCAAGAGG - Intronic
917488262 1:175475079-175475101 GAGCTCACTGGACATCCAGGGGG - Intronic
917969683 1:180198724-180198746 GGGTGCAGAGCACAACCAGGAGG - Exonic
918042686 1:180922778-180922800 GGAATCACAGGGCAGCCAGCTGG - Intronic
918182147 1:182093686-182093708 GTGTTCCCAGCACAGCAAGGCGG + Intergenic
919086585 1:192928096-192928118 GGTTTCCCAGGATATCCAGGAGG - Intergenic
920210557 1:204325318-204325340 GGGTTTAGAGGGCTGCCAGGGGG + Intronic
920979675 1:210821580-210821602 TGCTACACAGGAGAGCCAGGAGG + Intronic
921181002 1:212631043-212631065 AGGCTCACAGGAAAGCAAGGAGG + Intergenic
923318633 1:232805986-232806008 GGCTTCCCAGGTCAGTCAGGCGG - Exonic
923426971 1:233880497-233880519 GGGTCCTCAGGACTGTCAGGGGG + Intergenic
1062809593 10:452688-452710 GGGTCCTCAGCACAGCCGGGTGG + Intronic
1063134324 10:3203044-3203066 GGGTGCACAGGACATACAGAGGG - Intergenic
1064476903 10:15700366-15700388 GTGTTCACAGGACAGGAAGTTGG - Intronic
1067428304 10:46225758-46225780 GGGTCCACTGGCCAGCCAGGTGG + Intergenic
1067717440 10:48700216-48700238 GGGCCCACAGGAAAGCCTGGAGG + Intronic
1069894343 10:71671336-71671358 GGTCTCACAGGCCAGCCAGATGG - Intronic
1070770608 10:79080208-79080230 GGGCACACAGGGCAGACAGGCGG - Intronic
1074498628 10:114002303-114002325 GGGTACAGATGGCAGCCAGGAGG + Intergenic
1074507959 10:114087871-114087893 TGGTTCACAGGAGAGCCACTGGG - Intergenic
1075728086 10:124620831-124620853 GTGGGCACAGGACAGGCAGGCGG + Exonic
1076544649 10:131237096-131237118 ATGTTCACAGGCCAGCAAGGAGG - Intronic
1076976981 11:180383-180405 GGTATTTCAGGACAGCCAGGAGG - Intronic
1077486955 11:2843374-2843396 GGTTCCTCAGGACAGACAGGAGG + Intronic
1077497175 11:2891979-2892001 GGCTTCAAAGCTCAGCCAGGAGG - Intronic
1077585239 11:3446510-3446532 GGGCTCACAGTACAGACAGGAGG + Intergenic
1079077271 11:17391797-17391819 TGAGTCACAGGTCAGCCAGGTGG - Intergenic
1079320411 11:19447279-19447301 GGGTTCATAGGACAGACTGATGG - Intronic
1082726475 11:56743082-56743104 GGATTCTCAGGATAGCCAGGAGG + Exonic
1083200933 11:61120692-61120714 GTGCTTGCAGGACAGCCAGGTGG - Intronic
1083261591 11:61525984-61526006 GGGGGCACAGGCCAGCCTGGAGG + Intronic
1083302292 11:61745463-61745485 GGGTGCCCAGGCCAGCGAGGAGG - Exonic
1083732391 11:64659718-64659740 GTCTTCACAGGACAGCCATGAGG + Intronic
1084111777 11:67018878-67018900 GGGTGCACAGGGCAGACAAGTGG + Intronic
1084242143 11:67829073-67829095 GGGCTCAGAGTACAGACAGGAGG + Intergenic
1084745276 11:71166111-71166133 GGGATGACAGGACAGACTGGGGG + Intronic
1085311296 11:75518413-75518435 GGCTGCAGAGGGCAGCCAGGTGG + Intronic
1085351635 11:75801596-75801618 GGGCTCAGAGGGCAGCCAGCTGG - Intergenic
1085411979 11:76296820-76296842 CTGTTCAGAGGGCAGCCAGGTGG + Intergenic
1087204436 11:95378963-95378985 GGGTACAAAGGACTGCCAGCTGG + Intergenic
1087924034 11:103899013-103899035 GGGCTCCCAGGACAGGTAGGTGG - Intergenic
1088563661 11:111144196-111144218 GGGTTAACAGAACAGTGAGGAGG - Intergenic
1089443261 11:118532972-118532994 GGGCAAACAGGACAACCAGGAGG - Exonic
1090821740 11:130348856-130348878 GGGTGCACTGGACAGAAAGGAGG - Intergenic
1094040298 12:26114580-26114602 GGGTTCAAAGTACAGCCGCGCGG - Intergenic
1095683257 12:45003205-45003227 GTGTTTACAGGACAGCAAGGAGG - Intergenic
1095958230 12:47818794-47818816 GGGTGCGCAAGACAGCCAGCGGG + Intronic
1098900461 12:76106866-76106888 GGTTTCACAGGACAACCAAATGG - Intergenic
1099646167 12:85359482-85359504 GGGTCCCCACGTCAGCCAGGTGG - Intergenic
1100406621 12:94277570-94277592 GGGTTCAGAGGTCACCCAGCTGG + Intronic
1100994524 12:100289153-100289175 CGAGGCACAGGACAGCCAGGAGG - Intronic
1101019594 12:100539969-100539991 GTGTTCACAGCAGGGCCAGGTGG + Intronic
1102045561 12:109828150-109828172 GGGCTCAGGGGACAGACAGGCGG - Intronic
1102561015 12:113762452-113762474 GGGATCGGAGGTCAGCCAGGGGG - Intergenic
1102953604 12:117045819-117045841 GGGAACACACGACACCCAGGTGG + Intronic
1103541167 12:121667606-121667628 GTGTTCAAGGAACAGCCAGGAGG - Intronic
1103954487 12:124568580-124568602 GGGTTGTCAGGGCGGCCAGGGGG - Intergenic
1104911883 12:132243684-132243706 GTGGCCCCAGGACAGCCAGGTGG - Intronic
1104992448 12:132633769-132633791 GGCCTCACAGACCAGCCAGGGGG + Intronic
1105669242 13:22593743-22593765 GGGGTCACAGGAGTTCCAGGGGG - Intergenic
1105779935 13:23696740-23696762 GGAATCACAGGAAAGCCAGCCGG + Intergenic
1105914454 13:24900262-24900284 GTGTTCAAAGAACAGCCAGGAGG + Intronic
1112482791 13:99792458-99792480 GAGTACTCAGGACAACCAGGAGG + Intronic
1113481247 13:110623418-110623440 GGGATTCCAGAACAGCCAGGCGG + Intronic
1117630235 14:57683785-57683807 GGGCTCACAGGACTTCCAGTAGG + Intronic
1117799629 14:59429703-59429725 AGGTGCACATGACAGCCAAGAGG - Intronic
1122519528 14:102333764-102333786 GGGTTCACAGGACAGCCAGGTGG - Intronic
1123132661 14:106000491-106000513 GGGTGCACAGAACCACCAGGAGG - Intergenic
1123132685 14:106000572-106000594 GGGTGCACAGAACCACCAGGAGG - Intergenic
1123132722 14:106000730-106000752 GGGTGCACAGAACCACCAGGAGG - Intergenic
1123132746 14:106000811-106000833 GGGTGCACAGAACCACCAGGAGG - Intergenic
1123132789 14:106000989-106001011 GGGTGCACAGAACCACCAGGAGG - Intergenic
1123132813 14:106001070-106001092 GGGTGCACAGAACCACCAGGAGG - Intergenic
1123132837 14:106001151-106001173 GGGTGCACAGAACCACCAGGAGG - Intergenic
1123132861 14:106001232-106001254 GGGTGCACAGAACCACCAGGAGG - Intergenic
1123132885 14:106001313-106001335 GGGTGCACAGAACCACCAGGAGG - Intergenic
1123132909 14:106001394-106001416 GGGTGCACAGAACCACCAGGAGG - Intergenic
1123142573 14:106095134-106095156 GGGCTCTCAGAACAACCAGGAGG - Intergenic
1123144606 14:106116564-106116586 GGGTCCCCAGGACCACCAGGGGG - Intergenic
1123149842 14:106170434-106170456 GGGTGCTCAGGACCACCAGGGGG - Intergenic
1123156812 14:106234991-106235013 GGGTCCCCAGGACCACCAGGGGG - Intergenic
1123207583 14:106728092-106728114 GGGTCCCCAGGACCACCAGGGGG - Intergenic
1123212594 14:106775086-106775108 GGGTCCCCAGGACCACCAGGGGG - Intergenic
1123582729 15:21731015-21731037 GGGTACTCAGAACTGCCAGGGGG - Intergenic
1123582913 15:21731759-21731781 GGGTGCACAGAACTGCCAGGAGG - Intergenic
1123582936 15:21731840-21731862 GGGTGCACAGAACCACCAGGAGG - Intergenic
1123619379 15:22173611-22173633 GGGTACTCAGAACTGCCAGGGGG - Intergenic
1123619563 15:22174355-22174377 GGGTGCACAGAACTGCCAGGAGG - Intergenic
1123619586 15:22174436-22174458 GGGTGCACAGAACCACCAGGAGG - Intergenic
1124422872 15:29537853-29537875 TTGTTCACAGGACAGCAAGGAGG - Intronic
1125184169 15:36911635-36911657 AGGTTCAGAGGGCAGGCAGGTGG - Intronic
1128456457 15:67834110-67834132 GGGTTAACTGGACAGACGGGGGG + Exonic
1128779772 15:70351707-70351729 GGGTTCAAGGAACAGCCAGGAGG - Intergenic
1129032380 15:72628690-72628712 CTTTTCACAGGAAAGCCAGGTGG + Intergenic
1129217514 15:74108549-74108571 CTTTTCACAGGAAAGCCAGGTGG - Intronic
1129275464 15:74442560-74442582 GGTGCCATAGGACAGCCAGGTGG - Intergenic
1129785212 15:78305337-78305359 GAGATCACAGAACAGCCAGGTGG + Intergenic
1130435884 15:83899095-83899117 GGCTTCAAAGGACAGGAAGGGGG + Intronic
1130446111 15:84003506-84003528 GGGAACACAGGCCAGCCAGGAGG - Intronic
1132787337 16:1664947-1664969 GGGTGCCCAGCATAGCCAGGTGG - Intronic
1133233873 16:4378793-4378815 GGGGGCACACGACAGCAAGGGGG + Intronic
1133885943 16:9827737-9827759 GGGATCCCAGGAGATCCAGGTGG + Intronic
1135095801 16:19563821-19563843 GGGCTATCAAGACAGCCAGGAGG - Intronic
1135398131 16:22146790-22146812 GGGTTCAGAGGACAGGCAAGGGG + Intronic
1135971383 16:27074392-27074414 GGGTTCCCAGGAGAAGCAGGGGG + Intergenic
1136071152 16:27788080-27788102 GGGCTCAGGGGACAGCCAGCTGG - Exonic
1136191418 16:28617349-28617371 GGGTACTCAGCACAGCGAGGAGG - Intronic
1136626520 16:31465212-31465234 GGGTTCACAGGTCAGCGTGCTGG - Intronic
1136680229 16:31956417-31956439 GGGTGCTCAGGACACCAAGGGGG + Intergenic
1140841434 16:78842973-78842995 CGCTTCACAGGACTGGCAGGTGG + Intronic
1140877835 16:79169515-79169537 GCTTTAAAAGGACAGCCAGGAGG - Intronic
1141298561 16:82792199-82792221 GGGATGCCAGGACAGCAAGGTGG - Intronic
1141449411 16:84087608-84087630 CGTTTCACAGGACAGCCGTGAGG - Intronic
1141548350 16:84787189-84787211 GAGTACCCAGAACAGCCAGGAGG - Intergenic
1141729222 16:85810582-85810604 GTGTTCAAAGGACAGCAAGACGG + Intergenic
1142022830 16:87794873-87794895 GGGTCCACAGGGCACCGAGGTGG - Intergenic
1142142700 16:88479677-88479699 GGGGTCACAGCATTGCCAGGAGG - Intronic
1142241229 16:88947218-88947240 GGGTTTACAGGACAACTGGGCGG - Intronic
1142443279 16:90116287-90116309 GGTATTTCAGGACAGCCAGGAGG + Intergenic
1142464118 17:118557-118579 GGTATTTCAGGACAGCCAGGAGG - Intergenic
1143581608 17:7830875-7830897 GAGGTCACAAGTCAGCCAGGTGG + Intronic
1145009956 17:19362421-19362443 GGGGCCACAGGGCAGCCCGGGGG + Intronic
1145980324 17:29007253-29007275 TGAGTCACAGGACAGCAAGGGGG + Intronic
1151794000 17:76329920-76329942 GGGTTAACATGAGAGCCAGTGGG + Intronic
1151879591 17:76887153-76887175 GTGTTCCCAGGACACCCAGGTGG - Intronic
1152422975 17:80204002-80204024 GGGTGCAGAGGAGAGACAGGTGG - Intronic
1152456550 17:80420375-80420397 GGGTTCACAGAGAAGCCAGCAGG - Intronic
1152712240 17:81877867-81877889 GGGTTCACAGGACACCTGGAGGG - Intergenic
1155180157 18:23338080-23338102 GTGATCACAGAACAGCCAGCAGG + Intronic
1156494860 18:37519071-37519093 GGGCTCTCAGGACCTCCAGGTGG - Intronic
1157322804 18:46647188-46647210 GGGATCTCAGCAAAGCCAGGAGG + Intronic
1158397598 18:57091501-57091523 GATTGCACAGGTCAGCCAGGTGG + Intergenic
1159028865 18:63210842-63210864 GGGTCGCCAGGACTGCCAGGAGG - Intronic
1160161900 18:76479780-76479802 GAGACCACAGGGCAGCCAGGAGG - Intronic
1160418353 18:78727352-78727374 CGGTTTACATGACAGCCAGAAGG + Intergenic
1160432673 18:78822678-78822700 GGGTGCAGAGGCCACCCAGGCGG + Intergenic
1161221865 19:3121608-3121630 GGGTTGGAAGGACAGCCACGGGG - Exonic
1161370281 19:3907586-3907608 GGGTCAGCAGGGCAGCCAGGTGG + Intronic
1162306326 19:9876409-9876431 GGCTGGACAGCACAGCCAGGAGG + Intronic
1162953463 19:14085491-14085513 GGGTTCCCAGGCCTGCCAGGGGG + Exonic
1163128216 19:15255920-15255942 GGCTTCACAGGCCAGGCTGGTGG - Intronic
1163478813 19:17542516-17542538 GGGTTGACAGGACTTTCAGGAGG + Intronic
1163739823 19:19004501-19004523 GGGTTCTCAGGAGAGCCCCGTGG - Exonic
1163847725 19:19646803-19646825 GGCTACACAGGACAGGCTGGTGG - Intronic
1164879101 19:31715676-31715698 GGGGACACAGGGCAGCCAGGAGG + Intergenic
1165787909 19:38473439-38473461 GGGCTCCCAGAACAGCCTGGTGG + Exonic
1166693193 19:44836649-44836671 GGAAGCACTGGACAGCCAGGAGG + Intergenic
1166868855 19:45858343-45858365 ATGTTCACAGGACAGCGAGGAGG - Intronic
1167432553 19:49462746-49462768 GGGTGCACAGGTGAGGCAGGGGG + Exonic
1167499558 19:49837485-49837507 GGGGACACAGGAGAACCAGGAGG + Intronic
1168325365 19:55536231-55536253 GGCTTCGGAGGACAGCGAGGAGG - Exonic
926123667 2:10258258-10258280 GGGTTCAAAGGTGAGCAAGGAGG - Intergenic
927019471 2:19001727-19001749 AGGTTCACAGCACATGCAGGTGG - Intergenic
927138806 2:20115846-20115868 GGGTGCAGAGGGCAGCCTGGAGG - Intergenic
927249203 2:20982826-20982848 GGGTTCCCAGGACAGACACCTGG + Intergenic
928163062 2:28946907-28946929 GGGTGCTCAGGACAGCAAAGTGG - Exonic
928429307 2:31204732-31204754 GGATGCAGATGACAGCCAGGTGG - Intronic
929588268 2:43129638-43129660 GTGTTCACTGGCCAGCCAAGAGG - Intergenic
929814304 2:45219333-45219355 GGGTTCCCGGGCCAGCCAGAGGG + Intergenic
931075776 2:58710049-58710071 AGGTTCAAAGAACAGCAAGGAGG - Intergenic
935532528 2:104252687-104252709 GGGTTCAGAGGGAAGGCAGGAGG + Intergenic
937248559 2:120509713-120509735 GGGTGCAGCGCACAGCCAGGTGG - Intergenic
938118635 2:128618795-128618817 GGGTGCACAGGGCAGTCAGCAGG + Intergenic
945140729 2:206683694-206683716 GGATTCAAAGAACAGCAAGGGGG - Intronic
947871296 2:233440386-233440408 GGGTGCGCAGGTGAGCCAGGCGG + Intronic
948266514 2:236638929-236638951 GGCTGCACAGGACTGCCTGGGGG - Intergenic
948616259 2:239201257-239201279 GAGCTCACAGGTCACCCAGGGGG + Intronic
949028634 2:241777864-241777886 GGGGCCCCAGGGCAGCCAGGGGG - Intronic
1168820855 20:772957-772979 CTGTTCAAAGGACAGCTAGGAGG + Intergenic
1171278542 20:23878481-23878503 GGGATCACAGGACTTCCATGTGG - Intronic
1173713081 20:45177262-45177284 GGGTCAACAGGAGAGCCATGAGG - Intergenic
1174016596 20:47493584-47493606 TGGTTCAGAGTACAGCCTGGGGG + Intergenic
1174074766 20:47925799-47925821 TGATTCACAGGAAAGCCCGGGGG + Intergenic
1174372162 20:50098259-50098281 GGTGTCAAAGGACAGCAAGGAGG + Intronic
1175185384 20:57176426-57176448 GCCTTCACAGGGCAGCCAGTTGG - Intronic
1175405371 20:58722617-58722639 GGGTTCACAGTCCCGCCAGGAGG + Intergenic
1175714285 20:61245387-61245409 GGAGTCTCAGGACAGCCAGGAGG - Intergenic
1176003080 20:62842864-62842886 GGGTTCCAAGGCCAGCAAGGTGG + Intronic
1178124065 21:29498684-29498706 GGCTTTGCAGGACAGCAAGGAGG - Intronic
1179809920 21:43864445-43864467 GGGTTCGCAGGGCAGCCCCGGGG + Intergenic
1180132464 21:45835383-45835405 GGGGTCACAGCAAAGCCAAGTGG + Intronic
1180244135 21:46535012-46535034 GGGTTCACAGGCCTGCCCTGGGG + Intronic
1180946213 22:19695111-19695133 AGGCTCAGAGCACAGCCAGGAGG + Intergenic
1181064399 22:20298883-20298905 AGGTCCCCAGGCCAGCCAGGTGG - Intergenic
1181434464 22:22902168-22902190 GGCTTCTCAGGACATCCTGGTGG - Intergenic
1183466822 22:37984229-37984251 GGGTTTAGAGGAGAGCCAGGTGG + Intronic
1183471441 22:38009114-38009136 GCGTTCTGAGGACAGCCAGGAGG + Intronic
1183499184 22:38168264-38168286 TGGCTGACAGGACAGCCAGATGG + Intronic
1183502421 22:38188864-38188886 GGGTTCACAGGACAGACTGCGGG + Intronic
1183946102 22:41326654-41326676 GGGTGCACAGGACAGGGAAGAGG - Intronic
1184094438 22:42309036-42309058 GGCCTCACAGGACACCCTGGCGG + Intronic
1184274906 22:43404646-43404668 TGGTCCCCAGGACAGCCAGCAGG - Intergenic
1184502258 22:44881096-44881118 GAGTGCCCAGGGCAGCCAGGTGG - Intergenic
1184628274 22:45755027-45755049 TGGTGCTCAGGAAAGCCAGGTGG + Intronic
1184669542 22:46005563-46005585 GGGTCCCCAGGGCAGCCAGGTGG - Intergenic
1184891633 22:47382926-47382948 GGGTTTACAGGATACCCAGAAGG + Intergenic
1184992010 22:48176888-48176910 GGGTGCACAGAACAGACTGGCGG - Intergenic
1185077384 22:48690645-48690667 GAGTCCACAGGGCAGCCAGGAGG - Intronic
1185246908 22:49777602-49777624 CGGCTTCCAGGACAGCCAGGCGG + Intronic
949844594 3:8356919-8356941 GTGGTCACAGGACAGTCATGAGG + Intergenic
950421573 3:12902729-12902751 GGCGACACAGGACAGCCAGCTGG + Intronic
952392974 3:32896655-32896677 GGGTTAACAAGCCAGCCTGGTGG + Exonic
953435707 3:42875596-42875618 GTGTTCACAGTGCAGCTAGGGGG - Exonic
954582918 3:51712811-51712833 GGGTGAACAGGACAGCCACGCGG - Exonic
955729714 3:61972231-61972253 ATGTTCAAAGGACAGCAAGGTGG + Intronic
956569114 3:70674103-70674125 GTGTTCAAAGGGTAGCCAGGTGG - Intergenic
956939130 3:74136582-74136604 GGTTTAACAGGAGAGCCAAGGGG - Intergenic
957432121 3:80124181-80124203 AGGTTCACAGGAAAACCGGGTGG - Intergenic
960088450 3:113615132-113615154 GGGCTGCCAGGACAGCCAGGTGG - Intronic
962168713 3:133077915-133077937 GTCTTCCCAGGACAGCCCGGGGG + Intronic
963251256 3:143105376-143105398 GTGTTAACAGGAGACCCAGGTGG - Intergenic
963725450 3:148915471-148915493 AAGTTCACAGGCCAGCCTGGTGG - Intergenic
968044632 3:195617184-195617206 AGGTCCACAGGACAACCAGTTGG + Intergenic
968060420 3:195723235-195723257 AGGTCCACAGGACAACCAGTTGG + Intronic
968363596 3:198167675-198167697 GGTATTTCAGGACAGCCAGGAGG + Intergenic
968524589 4:1049506-1049528 GCTGTCCCAGGACAGCCAGGAGG - Intergenic
969000435 4:3976410-3976432 GGGCTCAGAGTACAGACAGGAGG + Intergenic
969112567 4:4852845-4852867 GGGTCCTCAGGACTGCCTGGGGG + Intergenic
969257040 4:6009188-6009210 GTGTTCCCAGGCCAGGCAGGTGG - Intergenic
970514127 4:16810737-16810759 GGGTTCACGGAAGATCCAGGGGG + Intronic
970898150 4:21127168-21127190 GGGCTCTTAGGACAGCCAAGAGG - Intronic
979278664 4:118840278-118840300 GGGTGGAGAGGACAGACAGGTGG + Intergenic
979737988 4:124112394-124112416 AGGTTCAAAAGACTGCCAGGTGG - Intergenic
981652744 4:147077795-147077817 GGGTTCAGAGAACTTCCAGGTGG + Intergenic
982084464 4:151819583-151819605 AGGTGCACAGGACAGGCATGAGG - Intergenic
985761833 5:1752954-1752976 TGGTGGCCAGGACAGCCAGGCGG + Intergenic
985955970 5:3266718-3266740 GGGTTAACAGGCCACGCAGGAGG - Intergenic
985986574 5:3521421-3521443 GGGGTCCCAAGGCAGCCAGGTGG + Intergenic
987029702 5:13964435-13964457 AGGCACACAGGACAGACAGGAGG + Intergenic
987330989 5:16857610-16857632 GGTTTCACAGGTCTTCCAGGAGG + Intronic
988716901 5:33837131-33837153 GTCTACACAGGACAGCCAGAGGG - Intronic
990301272 5:54451592-54451614 GTGTTCAAGGGACAGACAGGAGG + Intergenic
990350257 5:54908921-54908943 GGGTTTGCAGTGCAGCCAGGAGG - Intergenic
992895088 5:81238900-81238922 GAGTTCAGGGTACAGCCAGGTGG - Intronic
993370208 5:87083845-87083867 GGGTTCCCAGAACAACCAGAAGG - Intergenic
993920818 5:93798892-93798914 GGGTTGACAGGCCACCAAGGTGG + Intronic
994117877 5:96081333-96081355 GGCTGCACAGGGCATCCAGGTGG + Intergenic
997833512 5:137173341-137173363 AGGTTCACAGAACTACCAGGGGG - Intronic
1000436761 5:161220511-161220533 GGGTTCACAGGGCATCCAAAAGG - Intergenic
1000814862 5:165908603-165908625 GTGTTCACAGAACAGCAAAGAGG + Intergenic
1001483070 5:172101879-172101901 GTGTTCAGAGCACAGCAAGGCGG + Intronic
1002053420 5:176584744-176584766 TGGCTCACAGCACGGCCAGGTGG + Exonic
1002522712 5:179800430-179800452 GGGTTCTCAGCACAGGCAGGCGG + Intronic
1010369159 6:75087663-75087685 GAGTTTCCAGGACGGCCAGGGGG + Exonic
1016539525 6:145148668-145148690 TTGTTCACATGAGAGCCAGGTGG - Intergenic
1017159264 6:151350047-151350069 CGATTCTCCGGACAGCCAGGAGG + Exonic
1018710711 6:166496613-166496635 TGGTTCACCTGAGAGCCAGGTGG + Intronic
1018864594 6:167737005-167737027 GGGTGCACATGGCAGTCAGGAGG - Intergenic
1019252105 7:21008-21030 GGTATTTCAGGACAGCCAGGAGG - Intergenic
1026067922 7:67092049-67092071 GGGCTAACAGGACAGGGAGGAGG - Intronic
1027004584 7:74681958-74681980 GGGATCACAGGACAGGAATGTGG + Intronic
1027185731 7:75969514-75969536 GGTAACACAGGCCAGCCAGGTGG - Intronic
1028885767 7:95930936-95930958 GTGTTCACAGGACAGCTAATTGG + Intronic
1029462676 7:100705550-100705572 GGGTCCCCAGCACAGACAGGAGG + Intergenic
1030077886 7:105752117-105752139 AGGTTCACAGGACAGGCAGTCGG + Intronic
1030445145 7:109639775-109639797 AGGTTCAAGGGACAGCAAGGAGG + Intergenic
1031849954 7:126851563-126851585 GTGTTCAAAGGACAACAAGGAGG - Intronic
1031990247 7:128192782-128192804 GGGGTCCCAGGACAGCCCGCTGG - Intergenic
1032325338 7:130922958-130922980 GGGTTGTCAGGACAGCCTGGAGG - Intergenic
1033143832 7:138853664-138853686 GGTTCCACATGACAGCCAAGGGG - Intronic
1034960137 7:155359742-155359764 GGGGTCAGTGGACAGCCAGAAGG - Intronic
1036376800 8:8207587-8207609 GGGCTCAGAGTACAGACAGGAGG - Intergenic
1036852737 8:12215550-12215572 GGGCTCAGAGTACAGACAGGAGG + Intergenic
1036874108 8:12458072-12458094 GGGCTCAGAGTACAGACAGGAGG + Intergenic
1037770953 8:21799411-21799433 GGTTTCACATGTTAGCCAGGTGG + Intronic
1038425179 8:27460150-27460172 GGGTTCTCGGGACAGCATGGAGG - Exonic
1038676105 8:29624257-29624279 GAGTTGGCAGGAAAGCCAGGAGG - Intergenic
1040547224 8:48408078-48408100 GGGTGCACAGCAGGGCCAGGTGG - Intergenic
1041354248 8:56983407-56983429 GTGTTCAGAGGGCAGCAAGGAGG + Intronic
1041653760 8:60327976-60327998 GAGTTCACAGTGCAGACAGGGGG + Intergenic
1041831341 8:62157783-62157805 GGTTTCACAGGATAGCTAGGTGG - Intergenic
1042456803 8:69014487-69014509 GGGTCCACAGGGCAGGCAGAAGG + Intergenic
1045225027 8:100235758-100235780 GGGGTCACAGGGCAGCACGGGGG - Intronic
1045620556 8:103972627-103972649 ATGTTCACAGAACAGCAAGGAGG - Intronic
1046818038 8:118606967-118606989 GGGTGCACCAGCCAGCCAGGTGG - Intronic
1047829643 8:128616026-128616048 GGACTCAGAGGACAGGCAGGAGG + Intergenic
1048334190 8:133490837-133490859 GGGTGCACAGGACACCCTGTGGG + Intronic
1048468233 8:134685112-134685134 TGTTTCACAGGACAGCAGGGAGG - Intronic
1048819345 8:138366017-138366039 GGGTGCACAAGACAGCCATCAGG - Intronic
1052968427 9:34361006-34361028 GGGTTAACAAGCCAGCCTGGTGG - Intergenic
1053020015 9:34688255-34688277 GGGGTCAGATGACAGCAAGGAGG - Intergenic
1053409623 9:37907106-37907128 GAGTTCACAGACCAGCCATGGGG - Intronic
1054805336 9:69391786-69391808 GGGTTCACAGGACAGTCTCTCGG - Exonic
1054826976 9:69583084-69583106 TGTTCCACAGGACAGCCTGGGGG - Intronic
1056356140 9:85803764-85803786 GGGTTGTCAAGACAGCCAGACGG - Intergenic
1057195741 9:93114942-93114964 GGGGACTCAGGGCAGCCAGGAGG - Intergenic
1057497790 9:95574414-95574436 GGGTGCAGAGGATAGCCTGGGGG - Intergenic
1057497808 9:95574493-95574515 GGATGCAGAGGACAGCCTGGGGG - Intergenic
1057497818 9:95574533-95574555 GGATGCAGAGGACAGCCTGGGGG - Intergenic
1057497848 9:95574654-95574676 GGATGCAGAGGACAGCCTGGGGG - Intergenic
1057497878 9:95574774-95574796 GGATGCAGAGGACAGCCTGGGGG - Intergenic
1057497917 9:95574935-95574957 GGATGCAGAGGACAGCCTGGGGG - Intergenic
1057497936 9:95575015-95575037 GGACTCAGAGGACAGCCTGGGGG - Intergenic
1057895402 9:98904832-98904854 GAGTAAACAGGACAGCCTGGTGG + Intergenic
1060052934 9:120390088-120390110 GGGATACCTGGACAGCCAGGTGG - Intronic
1060509752 9:124223376-124223398 TAGTTCCAAGGACAGCCAGGTGG - Intergenic
1060759358 9:126234931-126234953 AGGATCACAGGACAGGCTGGTGG + Intergenic
1061662154 9:132137385-132137407 GGTTTCCCAGGACAGGCTGGAGG - Intergenic
1062051009 9:134447078-134447100 GGCTTCAAAGGGAAGCCAGGTGG + Intergenic
1062473025 9:136714503-136714525 GGCCTCGGAGGACAGCCAGGAGG - Intronic
1062592689 9:137281199-137281221 GGGCTCAGAGGGCAGCGAGGAGG + Exonic
1062599623 9:137314051-137314073 GAGTGCACAGGGCAGCCTGGGGG - Intronic
1062748236 9:138230907-138230929 GGTATTTCAGGACAGCCAGGAGG + Intergenic
1203441896 Un_GL000219v1:16447-16469 GGGGCTCCAGGACAGCCAGGAGG - Intergenic
1203512704 Un_KI270741v1:135356-135378 GGGGCTCCAGGACAGCCAGGAGG - Intergenic
1186082233 X:5945600-5945622 GGATTCCCAGGAAAGCCAGGAGG + Intronic
1189846263 X:45141638-45141660 GGGTGCTCTGGACAGCCAGTGGG + Intergenic
1190325429 X:49204424-49204446 GTGGTCTCAGGAAAGCCAGGTGG + Intergenic
1190337816 X:49273214-49273236 GGGTTCCCATGACAGCCGGCGGG - Intronic
1192223652 X:69214174-69214196 GACTTCACAGGGCAGTCAGGAGG - Intergenic
1196882423 X:120210509-120210531 GGGTTCAGAGGACAAGAAGGCGG - Intergenic
1198310352 X:135422979-135423001 GGGTTCAGGGGACACCCTGGGGG - Intergenic
1200077944 X:153561012-153561034 GGGGCTACAGGAAAGCCAGGTGG - Intronic
1200083113 X:153589112-153589134 TGGTTTACTGGACTGCCAGGCGG + Intronic
1200212848 X:154354559-154354581 GGGCTCACAGAACACCCAGCTGG + Intronic