ID: 1122519535

View in Genome Browser
Species Human (GRCh38)
Location 14:102333801-102333823
Sequence TCTGAGCAGAGCCCACAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 219}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122519529_1122519535 11 Left 1122519529 14:102333767-102333789 CCTGGCTGTCCTGTGAACCCCTC 0: 1
1: 0
2: 2
3: 29
4: 282
Right 1122519535 14:102333801-102333823 TCTGAGCAGAGCCCACAAGCTGG 0: 1
1: 0
2: 0
3: 21
4: 219
1122519530_1122519535 2 Left 1122519530 14:102333776-102333798 CCTGTGAACCCCTCTGCCTTTCA 0: 1
1: 0
2: 1
3: 25
4: 290
Right 1122519535 14:102333801-102333823 TCTGAGCAGAGCCCACAAGCTGG 0: 1
1: 0
2: 0
3: 21
4: 219
1122519528_1122519535 14 Left 1122519528 14:102333764-102333786 CCACCTGGCTGTCCTGTGAACCC 0: 1
1: 0
2: 0
3: 32
4: 304
Right 1122519535 14:102333801-102333823 TCTGAGCAGAGCCCACAAGCTGG 0: 1
1: 0
2: 0
3: 21
4: 219
1122519531_1122519535 -6 Left 1122519531 14:102333784-102333806 CCCCTCTGCCTTTCATGTCTGAG 0: 1
1: 0
2: 0
3: 40
4: 341
Right 1122519535 14:102333801-102333823 TCTGAGCAGAGCCCACAAGCTGG 0: 1
1: 0
2: 0
3: 21
4: 219
1122519533_1122519535 -8 Left 1122519533 14:102333786-102333808 CCTCTGCCTTTCATGTCTGAGCA 0: 1
1: 0
2: 1
3: 30
4: 398
Right 1122519535 14:102333801-102333823 TCTGAGCAGAGCCCACAAGCTGG 0: 1
1: 0
2: 0
3: 21
4: 219
1122519532_1122519535 -7 Left 1122519532 14:102333785-102333807 CCCTCTGCCTTTCATGTCTGAGC 0: 1
1: 0
2: 0
3: 25
4: 275
Right 1122519535 14:102333801-102333823 TCTGAGCAGAGCCCACAAGCTGG 0: 1
1: 0
2: 0
3: 21
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122519535 Original CRISPR TCTGAGCAGAGCCCACAAGC TGG Intronic