ID: 1122520636

View in Genome Browser
Species Human (GRCh38)
Location 14:102341236-102341258
Sequence TTGGCCTAGCTGGTTTTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 181}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122520628_1122520636 27 Left 1122520628 14:102341186-102341208 CCAAGGAGCAAGGAGCATCGATG 0: 1
1: 0
2: 1
3: 5
4: 120
Right 1122520636 14:102341236-102341258 TTGGCCTAGCTGGTTTTGGGTGG 0: 1
1: 0
2: 0
3: 14
4: 181
1122520627_1122520636 28 Left 1122520627 14:102341185-102341207 CCCAAGGAGCAAGGAGCATCGAT 0: 1
1: 0
2: 0
3: 1
4: 77
Right 1122520636 14:102341236-102341258 TTGGCCTAGCTGGTTTTGGGTGG 0: 1
1: 0
2: 0
3: 14
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122520636 Original CRISPR TTGGCCTAGCTGGTTTTGGG TGG Intronic
901034868 1:6330404-6330426 TGGGCCTAGCGTGTGTTGGGGGG + Intronic
901495912 1:9621746-9621768 TGGGCCAAGCTAATTTTGGGAGG + Intergenic
902644316 1:17787918-17787940 TTGGCCTTGTTAGTTTTGTGGGG + Intronic
904191093 1:28744383-28744405 TTGGCCTAGCTGGGGTTTTGTGG + Intronic
904439816 1:30522924-30522946 TTGGCCCACGTGGTTTTGAGGGG - Intergenic
905650817 1:39655683-39655705 CTGGCCATGCTGGTTTAGGGAGG - Intergenic
909576872 1:77185567-77185589 TGGGCCTAACTGGATTTTGGAGG + Intronic
912252078 1:108021679-108021701 TGGGCCTATTTGGATTTGGGAGG - Intergenic
912926177 1:113915238-113915260 TCTGCCTGGCTGGTGTTGGGAGG + Intergenic
914266815 1:146045040-146045062 TTAGCCAAGCTGGTTTTGAGAGG - Intergenic
915640969 1:157225855-157225877 TTGGCCAAGCTAATTTTGGAAGG - Intergenic
916204403 1:162301318-162301340 TGGGGCTAGCTGGTTTTCTGGGG - Intronic
916393872 1:164364155-164364177 TTTGCCTAGTTGGCTTTTGGAGG - Intergenic
921617660 1:217289889-217289911 TAGTCCTAGCTACTTTTGGGAGG + Intergenic
924090344 1:240494643-240494665 TTTCCCTAGCTGACTTTGGGAGG + Intronic
924774259 1:247104535-247104557 TTGGCCTAGCGGTTTGTAGGCGG + Intergenic
1067058150 10:43064391-43064413 CAGGGCTAGCTGGTGTTGGGGGG - Intergenic
1068401208 10:56529835-56529857 TTGGCCAATCTGGTTTAGGTAGG - Intergenic
1069372123 10:67759533-67759555 TTGGCCTAGCTTGAATTGTGTGG + Intergenic
1069935058 10:71909751-71909773 TAGGCCAAGCTGACTTTGGGAGG - Intergenic
1071098482 10:82008043-82008065 CAGGCACAGCTGGTTTTGGGGGG + Intronic
1071364512 10:84884816-84884838 TGGGCCTATCTGGATTTTGGAGG - Intergenic
1071724237 10:88180106-88180128 TTGCACTAGCTGTCTTTGGGTGG + Intergenic
1071937642 10:90548985-90549007 TGGGCCTATTTGGATTTGGGAGG + Intergenic
1075146838 10:119889768-119889790 TAGGCCTCGGTGGTTTTGGAGGG - Intronic
1075845817 10:125544436-125544458 TTGGCCAGGCTGATTTAGGGGGG - Intergenic
1076249897 10:128977523-128977545 TTGGCCTGGCAGGTTGGGGGTGG - Intergenic
1077262036 11:1627599-1627621 TCAGCCTAGCTCGTTTTAGGAGG + Intergenic
1077440278 11:2565633-2565655 GTGGCCTATCTTGTTTTGGGGGG + Intronic
1077700375 11:4435747-4435769 TTGGACAAGCTGGTTTTAGAAGG - Intergenic
1078619347 11:12893159-12893181 TTGGCCTTCCAGGTTTGGGGAGG + Intronic
1079028687 11:16968896-16968918 TTGGCATAGGTGGGTATGGGGGG - Intronic
1079031144 11:16987304-16987326 TTGGCCTAGCTGGCTTCTGGGGG - Intronic
1081755355 11:45540442-45540464 TGGGGCTAGATGGTTTAGGGTGG - Intergenic
1082687428 11:56258274-56258296 TTGGCTCATCTGATTTTGGGAGG + Intergenic
1083995690 11:66270969-66270991 TTGGGCTAGCTGTTTGTGGAGGG + Intronic
1085038973 11:73315841-73315863 TGGGACCAGCTGGGTTTGGGAGG + Intronic
1085590176 11:77752891-77752913 GTGGCCATCCTGGTTTTGGGGGG - Intronic
1087140787 11:94763789-94763811 TTGGGCTTGCTGGTTCAGGGTGG + Intronic
1089309549 11:117548648-117548670 TTGGCCCAGCTGTTATGGGGAGG - Intronic
1090256818 11:125290248-125290270 TGGGCAGAGCTGGCTTTGGGAGG - Intronic
1091102313 11:132886564-132886586 TTGGCCTAGCTGGATTGGGCAGG - Intronic
1100371579 12:93973572-93973594 TTGGACTAGCTGGGAGTGGGAGG + Intergenic
1101443671 12:104721977-104721999 TTTGCCTGTTTGGTTTTGGGGGG + Intronic
1101545850 12:105712039-105712061 TTGGCATGGCTGGGGTTGGGGGG + Intergenic
1103458378 12:121085216-121085238 TAGTCCTAGCTGGTTTGGGCTGG - Intergenic
1103927280 12:124429874-124429896 TTGGCCTTGCTGGGTTGGGGTGG - Intronic
1103944496 12:124518449-124518471 TTGGCCTGCCCGGGTTTGGGGGG - Intronic
1104259592 12:127170582-127170604 TTGCCCTGGCTGGTGGTGGGGGG - Intergenic
1105295035 13:19081282-19081304 TTTGATTTGCTGGTTTTGGGGGG - Intergenic
1105948839 13:25211969-25211991 GGGGCCTATCTGGATTTGGGAGG + Intergenic
1107983617 13:45756282-45756304 TGGGCCTAACTGGATTTTGGAGG - Intergenic
1107997275 13:45873085-45873107 CTGGCCTAGCTGGGTTCTGGAGG + Intergenic
1108302483 13:49092300-49092322 TGGGCCTAACTGGATTTTGGAGG - Intronic
1119307764 14:73621422-73621444 TTGGACTAGATGGTTGTGGGAGG - Intergenic
1120902078 14:89584190-89584212 TTGGCCAGGCTGGTCTTGGCCGG - Intronic
1121137993 14:91515813-91515835 TAGGCCAAGCTAGCTTTGGGAGG + Intergenic
1121159784 14:91726810-91726832 CTGCCCTAGCTGGTTCTGAGGGG - Intronic
1121328596 14:93035854-93035876 TGGGCCCAGCTGGTTTCTGGTGG - Intronic
1122520636 14:102341236-102341258 TTGGCCTAGCTGGTTTTGGGTGG + Intronic
1125774526 15:42199701-42199723 TTGCCCTACCTGCATTTGGGAGG - Intronic
1126675294 15:51155489-51155511 TGGGCCAGGCTGGTTTTGGAGGG + Intergenic
1129515097 15:76152473-76152495 CTGCCCTAGCTGGTGGTGGGTGG + Intronic
1131442066 15:92466906-92466928 GTGGGCCAGCTGGTGTTGGGTGG + Exonic
1135791519 16:25400984-25401006 TTGGGATAGCTGGATTTGGTAGG + Intergenic
1136250895 16:29004275-29004297 TTGGCCTATTTGGATTTTGGAGG + Intergenic
1138227167 16:55305902-55305924 TAGGCCTGGCTGGTCTTAGGTGG - Intergenic
1139408135 16:66736034-66736056 TTGGCTTGGCTGGGTTCGGGTGG - Intronic
1139476647 16:67206138-67206160 TTGGGGTAGCTGGTATTGAGAGG - Intergenic
1139905225 16:70360679-70360701 TTTGCATAGCTGGCTTTGGAAGG + Intronic
1141539904 16:84712067-84712089 TTGCCCTTGCTGCTTTTGGGTGG + Intronic
1143051075 17:4126379-4126401 TTGTCTTAGTGGGTTTTGGGAGG - Intronic
1144462865 17:15472098-15472120 TTGGCTTTGCTTGTTTTGGGGGG - Intronic
1149685023 17:58530377-58530399 CTGGCATAGCTGGGTTGGGGGGG + Intronic
1150214613 17:63459759-63459781 GTGGACTGGCTGGCTTTGGGGGG - Intergenic
1153047698 18:871791-871813 TTCAACTAGCTGGTTTTGGCTGG - Intergenic
1153607478 18:6848688-6848710 ATAGCTTAGCTGGTTTGGGGTGG - Intronic
1156721882 18:40080145-40080167 TTGGCCTAACTGCTTTTCTGTGG - Intergenic
1161283001 19:3455927-3455949 TTGTCCTGGCTGGGGTTGGGGGG - Intronic
1161379927 19:3959504-3959526 TCGGCGTAGCTGTTGTTGGGCGG + Exonic
1165607233 19:37116159-37116181 TTGGCCAAGCTGGTCTTTGTGGG - Intronic
1165820964 19:38675817-38675839 TTGGCCTGGCTGGGTATGGCAGG - Intronic
1167427096 19:49434946-49434968 TGGGCCTAGCTTGCTGTGGGCGG - Intronic
1168539388 19:57197694-57197716 TGGGCCTATTTGGTTTTTGGAGG - Intronic
927614766 2:24581573-24581595 TTTGGCTGGTTGGTTTTGGGGGG + Intronic
929865915 2:45717156-45717178 TGGGCCTAGCCTGTTGTGGGAGG - Intronic
930536650 2:52652580-52652602 TGGGCCTATCTGGATTTTGGAGG - Intergenic
930814615 2:55581515-55581537 TTGGCCTAGTCAGTTTTAGGTGG - Intronic
932831237 2:74992082-74992104 TAGCCCTAGCTGGTCTTGGCTGG + Intergenic
933744121 2:85558295-85558317 TTGATCTAGGTGGATTTGGGAGG - Intronic
934662508 2:96150603-96150625 CTGGTATTGCTGGTTTTGGGGGG - Intergenic
934979742 2:98829918-98829940 TTGGCTCAGAGGGTTTTGGGGGG - Intronic
935337299 2:102028270-102028292 CTGGCCTTCTTGGTTTTGGGGGG + Exonic
940023967 2:149185462-149185484 TTGGCATAGGTGGTTTTAGTGGG + Intronic
940343524 2:152605230-152605252 TTGGCCCAGGTGGTGCTGGGGGG - Intronic
941698435 2:168577875-168577897 TTGGCCTATCTGCATGTGGGTGG + Intronic
942147925 2:173044320-173044342 TAGTCCTAGCTGGTTTGGGCTGG + Intronic
945065629 2:205945605-205945627 TGGGCCAAGCTGGTTGGGGGTGG - Intergenic
945996770 2:216443823-216443845 TTGTCCTGGTTTGTTTTGGGGGG + Intronic
946451443 2:219783504-219783526 TTGGCCTCGCTGGGTACGGGAGG + Intergenic
946875266 2:224123465-224123487 TTGGCCTGGCTGATCTTGGTTGG + Intergenic
948878727 2:240844560-240844582 GTGGCATGGCAGGTTTTGGGAGG + Intergenic
1169914216 20:10671634-10671656 TTGGCCTAGCCTGTGCTGGGAGG - Intronic
1170953102 20:20954520-20954542 TAGTCCTAGCTGGTTTTGGCCGG + Intergenic
1173193043 20:40890864-40890886 TTGGCTTACTTGGTTTGGGGAGG + Intergenic
1173288188 20:41691649-41691671 TAGTCCTAGCTGGTTTGGGCTGG - Intergenic
1174124974 20:48297611-48297633 TTGGTCTAGCTGGTTGGGGCAGG - Intergenic
1177505613 21:22014506-22014528 TTGGCCTATTTGGATTTTGGAGG - Intergenic
1180104969 21:45612582-45612604 TTGCCCTAGGAGGTTTTAGGAGG - Intergenic
1181746057 22:24955650-24955672 TTGCCCTGGCTGGTGTGGGGAGG + Intronic
1182098402 22:27641339-27641361 TTGGTGTAGCTGCTTTTTGGTGG - Intergenic
1183298487 22:37046324-37046346 TTGGGGTAGGTGGGTTTGGGAGG - Intergenic
1183642390 22:39100578-39100600 TTGGCTTAGCTGGATCTGAGTGG + Intronic
1183915061 22:41111169-41111191 TTGGCCAGGCTGGTCTTGGCTGG + Intronic
950246081 3:11419849-11419871 TTTTCCTTGCTTGTTTTGGGAGG - Intronic
950421219 3:12901011-12901033 TTGGCCTTGCTGCTGGTGGGGGG + Intronic
950705303 3:14775821-14775843 TGGTCCTAGCTGGTTTGGGCCGG + Intergenic
951316071 3:21191088-21191110 TTGACCTTGCTGTTTTAGGGTGG - Intergenic
951382254 3:21998013-21998035 TAGTCCTGGCTGGTTTTGGCTGG - Intronic
954957665 3:54536505-54536527 TTGGCCTGGCTGGTTTCTGGAGG - Intronic
955393871 3:58541442-58541464 TAGGCCAAACTGATTTTGGGAGG + Intergenic
956676513 3:71738288-71738310 TTGGCCTTGCTGGCTTAGGTAGG - Intronic
958454960 3:94319262-94319284 TTGCCCTAGCTTCTTTTGGGTGG + Intergenic
958963705 3:100535317-100535339 TTGGCCAGGCTGGTTTTGAATGG + Intronic
965913973 3:173818535-173818557 TTTGCCTGGTTGGTTGTGGGTGG - Intronic
966445644 3:179998240-179998262 TGGGCCTATCTGGATTTTGGAGG + Intronic
970540254 4:17070575-17070597 TGGGCTTAGCTGATTTTGGCTGG - Intergenic
973143646 4:46798290-46798312 TAGGCCTCTCTGGATTTGGGAGG + Intronic
976364453 4:84217574-84217596 TGGGCATAACTGGTATTGGGTGG + Intergenic
980321206 4:131279017-131279039 TAGGGCTAGCTGGGTTTGGTGGG - Intergenic
980385878 4:132087722-132087744 TGGGCCTATTTGGTTTTTGGCGG - Intergenic
982163600 4:152594465-152594487 CTGACCTAGGTGGTCTTGGGTGG - Intergenic
983401190 4:167268373-167268395 TTGGCCATGTTGGTTTTGGTGGG - Intergenic
983778526 4:171639940-171639962 TTGGCCATGCTAGCTTTGGGAGG + Intergenic
984523487 4:180828036-180828058 TTGACATAGCTGGTTCTGGAAGG - Intergenic
986037077 5:3950751-3950773 TGGGCCTATTTGGATTTGGGAGG - Intergenic
986371588 5:7085809-7085831 ATGGCCCTGCTGGTTATGGGAGG + Intergenic
988817614 5:34850317-34850339 TTTTCCCAGCTGGGTTTGGGTGG + Intronic
991716426 5:69454992-69455014 TTGGCCCAGCTGGTTTGGTTTGG - Intergenic
992242891 5:74789433-74789455 TTGGCCTATTTGGATTTTGGAGG + Intronic
996393339 5:122987326-122987348 CTGATCTAGCTGGTCTTGGGTGG - Intronic
997713193 5:136023274-136023296 TTAGCAAAGCTGGTTTTGGAGGG + Intergenic
1000223288 5:159234565-159234587 TTGGCCTATTTGGATTTTGGGGG - Intergenic
1000281169 5:159783540-159783562 TTGACCTCAGTGGTTTTGGGGGG + Intergenic
1001954713 5:175841244-175841266 TTGGGTTTGCAGGTTTTGGGGGG - Intronic
1002580448 5:180207171-180207193 CTGACCTAGCAGGTTTTGGTTGG + Intronic
1002717745 5:181238954-181238976 TTAGCCAAGATGGTTTTAGGAGG - Intronic
1004832530 6:19492713-19492735 TTTGCCTATGTGGTTATGGGTGG - Intergenic
1008959346 6:57249957-57249979 TTGGCCTTCCTGCTGTTGGGAGG + Intergenic
1009806450 6:68606634-68606656 TGGGCCTATTTGGTTTTTGGAGG + Intergenic
1010190377 6:73189243-73189265 TTTGCTTAAATGGTTTTGGGGGG + Intronic
1010818586 6:80388087-80388109 TGGGCCTATTTGGATTTGGGAGG + Intergenic
1010938288 6:81886730-81886752 TGGGCCTATCTGGATTTTGGAGG - Intergenic
1015228525 6:130886418-130886440 TTGGACTTGCTGGTGTTGAGGGG - Intronic
1015300924 6:131652189-131652211 TGGGCAAAGCTGCTTTTGGGTGG + Intronic
1015343307 6:132127183-132127205 TTGGCCTCACTGGTCTTGGCTGG + Intergenic
1018459544 6:163984915-163984937 TTGGCCTAGAGATTTTTGGGAGG + Intergenic
1019780547 7:2937279-2937301 TGGGCCCAGCTGGATTTGGCTGG - Intronic
1021154646 7:17195095-17195117 TTGGCTTAGATGCTTTTGGGGGG - Intergenic
1021748397 7:23768053-23768075 TTGGCCTGGCTGGGTTTGTCGGG - Intronic
1029895353 7:103977524-103977546 TTGGCCTAGCAGGGGTAGGGTGG - Intronic
1029982527 7:104892503-104892525 TTGGCCAGGCTGGTTTTGAACGG - Intronic
1030076246 7:105739435-105739457 GTGGCTTAGTTGGTTTGGGGTGG + Intronic
1030222236 7:107109204-107109226 TAGTCCTAGCTGGTTTGGGCTGG + Intronic
1031805857 7:126305190-126305212 TGGTCCTAGTTGGTTTTGGCTGG - Intergenic
1033036800 7:137882918-137882940 TTTCCCTAGATGGTTATGGGTGG - Intronic
1035595249 8:852723-852745 TCAGCCTTGCTGGGTTTGGGTGG - Intergenic
1039432905 8:37539552-37539574 TTGACCTGGCTGGTTTAAGGTGG - Intergenic
1041622263 8:59985765-59985787 TAGTTCTAGCTGGTTTTTGGTGG + Intergenic
1042916304 8:73878834-73878856 CTGGCCTCGCCGGTCTTGGGGGG - Exonic
1043160504 8:76840851-76840873 GTGGCCAAGCTGGATTTGGGAGG - Intronic
1043444277 8:80304141-80304163 TAGGCCAAGCTAATTTTGGGAGG - Intergenic
1045652201 8:104351808-104351830 TGGTCCTAGCTGATTTTGGCTGG + Intronic
1047842566 8:128768887-128768909 TTAGACAAGCTTGTTTTGGGTGG - Intergenic
1048035129 8:130670786-130670808 ATGGCCTAGCTGGGTCGGGGCGG + Intergenic
1049319189 8:141986983-141987005 TTGGGGGAGCTGGATTTGGGGGG - Intergenic
1049766061 8:144355777-144355799 TTGGCCTTGGTGGCTATGGGTGG - Intronic
1050526687 9:6552600-6552622 TTGGCATAGCTGCGTTTTGGGGG + Intronic
1051690307 9:19705567-19705589 TAGTCCTGGCTAGTTTTGGGGGG - Intronic
1052608633 9:30739209-30739231 TAGCCCTAACTGGTTTTGGCTGG + Intergenic
1055286220 9:74730862-74730884 GTGGCCTTCCTGGTTTTGTGGGG - Intronic
1055511066 9:76996068-76996090 TTCCCCTCTCTGGTTTTGGGTGG + Intergenic
1056137225 9:83642275-83642297 ATGGCCTAGATGGTTTTAGATGG - Intronic
1056475602 9:86948266-86948288 ATGGCCTAGCTGGGGCTGGGGGG - Intergenic
1056491592 9:87113135-87113157 TTGGCATGTCTGGGTTTGGGTGG - Intergenic
1057439343 9:95071620-95071642 TTGGTCTTGATGGTTTTTGGTGG + Intronic
1058259299 9:102809984-102810006 TGGGCCTATCTGGATTTTGGAGG - Intergenic
1061485969 9:130920686-130920708 CTGGCCTATCTGGTTTAAGGAGG - Intronic
1185469831 X:375668-375690 TTCCCCTAGCTGCGTTTGGGAGG - Intronic
1188197893 X:27261210-27261232 ATAGTTTAGCTGGTTTTGGGGGG + Intergenic
1189310834 X:40016114-40016136 TTGGCCAAGCAGATTTTGGGGGG + Intergenic
1192212477 X:69136791-69136813 CCGGCCTAGCTGGGTCTGGGTGG - Intergenic
1192862192 X:75086828-75086850 TGGATCTAGCTGGTTTTGGCTGG - Intronic
1195065759 X:101236865-101236887 TTGGCCTAGGTGGTGGTGAGGGG + Intronic
1196724480 X:118884008-118884030 TTGCCTTAGTTGGTTTTGTGTGG - Intergenic
1199904731 X:152213596-152213618 TTGCATTTGCTGGTTTTGGGGGG - Intronic