ID: 1122531651

View in Genome Browser
Species Human (GRCh38)
Location 14:102431997-102432019
Sequence GCCCTTGCCCAGCTCAGGGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 309}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122531651_1122531659 20 Left 1122531651 14:102431997-102432019 CCACCCCTGAGCTGGGCAAGGGC 0: 1
1: 0
2: 2
3: 35
4: 309
Right 1122531659 14:102432040-102432062 ATTCAACGCCATCAGCTCAGAGG 0: 1
1: 0
2: 0
3: 5
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122531651 Original CRISPR GCCCTTGCCCAGCTCAGGGG TGG (reversed) Exonic
900113464 1:1019392-1019414 GCCCCTTCCCAGCTCTGGGCCGG - Intergenic
900386171 1:2412106-2412128 TCCCGTCCCCAGCTCAGGGCAGG - Intronic
900457322 1:2783578-2783600 GCCCAGGCCCAGGTCAGGAGTGG + Intronic
900934890 1:5758991-5759013 ACCCATGCCCAGCACAGGGCAGG + Intergenic
900991933 1:6102056-6102078 GCCCAGGCCCAGCTAAGAGGGGG - Exonic
901490438 1:9593813-9593835 AGCCTTGTCCGGCTCAGGGGTGG + Intronic
901512549 1:9724683-9724705 GCCCTTGCCCTGATAATGGGTGG - Intronic
901632653 1:10655496-10655518 CCCCTGGCCCAGCACAGGGATGG - Intronic
901657737 1:10779999-10780021 CTCCTGGCCCAGCTCAGGGTGGG - Intronic
902515555 1:16987705-16987727 GGCCATGCCCAGAGCAGGGGAGG + Intronic
902519271 1:17006756-17006778 GCCCGTGCCCAGCCCAGGTCTGG + Intronic
902866952 1:19285984-19286006 GAACTTGCCCTGCTCAGGTGAGG + Exonic
902893400 1:19461431-19461453 GCCCATGCTCAGCTCAGGCTGGG - Intronic
902962007 1:19970458-19970480 GCCCTGCCCCATCTCAGGGAGGG + Intergenic
902997291 1:20236424-20236446 CCCCTTCCCCAGCTCAGAGTGGG - Intergenic
903674614 1:25056037-25056059 TCCCTTCCCCAGCACAGTGGAGG - Intergenic
905890535 1:41516104-41516126 TCCCCTGCCCAGCTCGGGGCTGG + Intronic
906168386 1:43704893-43704915 GCCCTTACTCAGCTCAGCTGAGG - Exonic
906240003 1:44237005-44237027 GCCCTTGACTACCTCAAGGGTGG - Intronic
907323312 1:53619219-53619241 CCCAGTGCCCAGCTCAGGGTGGG - Intronic
910675551 1:89812792-89812814 GCCCTTGCTCAGCTCAGGCAGGG - Intronic
912372819 1:109186935-109186957 GCCAAGGCCCAGCTCAGAGGAGG + Intronic
914980560 1:152410974-152410996 GCCCATGTCCTCCTCAGGGGAGG - Intronic
915219971 1:154366911-154366933 GCGGTTGCCCAGATCTGGGGTGG + Intergenic
915324378 1:155073454-155073476 GAACCTGCCCAGCCCAGGGGAGG + Intergenic
915631273 1:157155384-157155406 ACACATGCCCAGCTCAGGAGAGG - Intergenic
918378637 1:183933416-183933438 GCTCAGGCCTAGCTCAGGGGAGG - Intronic
919705358 1:200670086-200670108 GCCCCCGCCCAGCTCTGGGCTGG + Intergenic
920034826 1:203059109-203059131 TCCCTTGCCTGGATCAGGGGTGG - Intronic
920081786 1:203380089-203380111 GCCCTCTCCCTGCACAGGGGAGG + Intergenic
920773077 1:208908497-208908519 GAGCTTGCCCTGCTCAGTGGTGG - Intergenic
922196272 1:223363277-223363299 GGCCCTGCACAGCTCACGGGCGG - Exonic
923069499 1:230549609-230549631 GCCCTTTCCCTGCTCAGAGCAGG - Intergenic
923273919 1:232380304-232380326 GCCTTGCCCCAGCTCAGGGATGG + Intergenic
924825220 1:247531690-247531712 GAACTTGCCCTGCTCATGGGAGG + Exonic
924856525 1:247879884-247879906 GCCCTTGCCAGGCTCAGTGGAGG + Intergenic
1063371416 10:5525171-5525193 GACCGTGCCCAGCTCGCGGGTGG - Exonic
1066064224 10:31750526-31750548 GGCCCCGGCCAGCTCAGGGGAGG + Intergenic
1066314433 10:34230083-34230105 TTCCTTGCCCAGCTCTGGGGAGG + Intronic
1067036632 10:42925707-42925729 GCCCTTGGCCCACTCAGAGGTGG - Intergenic
1067177290 10:43959012-43959034 CCCCCTGCCCAGCTCTTGGGAGG + Intergenic
1067296503 10:44977860-44977882 GGCCTTGTCCAGCACAGAGGTGG + Exonic
1069881423 10:71596082-71596104 TGCCTGGCCCTGCTCAGGGGTGG + Intronic
1071495416 10:86164518-86164540 GCCCTCACCCAGCACAGTGGAGG + Intronic
1072472295 10:95723869-95723891 GCCCTTTCCCAGCACAGGCACGG + Intronic
1073105839 10:101031731-101031753 GCCCCTCCACATCTCAGGGGTGG + Intronic
1074721748 10:116271165-116271187 GCCCTCGCCCGGAGCAGGGGCGG - Intronic
1075163067 10:120041709-120041731 GCCCTCGCCTAGCTCCTGGGAGG + Intergenic
1075719860 10:124578292-124578314 CCCCGTGACCACCTCAGGGGCGG + Intronic
1076139351 10:128067593-128067615 TCCCTTGCCCAGATCACGGAAGG - Intronic
1076199519 10:128547141-128547163 GCCTTGGCCCAGCACAGGTGTGG - Intergenic
1076597752 10:131636300-131636322 CCCCTTGCCCAGCTCATGGAAGG - Intergenic
1077363988 11:2154205-2154227 GCCCATGCCCAGCCAGGGGGAGG + Intronic
1077600229 11:3569543-3569565 GCACTTCCCCAGCTCAGCGGGGG + Intergenic
1078430235 11:11282599-11282621 GCCCTTGCCTATCACAGTGGTGG + Intronic
1080503865 11:32893453-32893475 GCCCTCGGCCAGCTCGGGGGAGG + Intronic
1080641039 11:34158500-34158522 GGCCTTGCCCTGCACAGGAGTGG - Intronic
1084063890 11:66692551-66692573 GTCCTGGCCCAGCTCGTGGGAGG + Exonic
1084256141 11:67944157-67944179 GCACTTCCCCAGCTCAGTCGGGG + Intergenic
1084441096 11:69173894-69173916 CCCATTGACCAGCTCAAGGGTGG - Intergenic
1084470582 11:69356864-69356886 GACCTGGCCCAGCTCGGGGAGGG + Intronic
1084669261 11:70595686-70595708 GCCCTTCCCCAGCTGCTGGGAGG + Intronic
1084702881 11:70799000-70799022 GTTCTTGCCCAGCTTAGGAGGGG - Intronic
1084816617 11:71651142-71651164 GCACTTCCCCAGCTCAGTCGGGG - Intergenic
1085941072 11:81207536-81207558 GGCCTTGGCCAGCTCAGAGAAGG - Intergenic
1088750720 11:112840112-112840134 GCTTTTGCAGAGCTCAGGGGAGG + Intergenic
1090202427 11:124866053-124866075 GCCCGGGCCCAGCGCAGGGAGGG + Intronic
1090838317 11:130469423-130469445 GCCCTGCCCCAGCTCAGGTGAGG + Exonic
1090990798 11:131815374-131815396 GCTCTGGCCCAGCACAGGGTGGG - Intronic
1091230711 11:133986283-133986305 GACCTGGCCCACCACAGGGGTGG - Intergenic
1091238886 11:134039404-134039426 GCCCATGTCCAGCTCAGGCTGGG + Intergenic
1091370901 11:135056875-135056897 CCCCATCCCCAGCCCAGGGGAGG - Intergenic
1092172729 12:6383936-6383958 GCCCTGGCCCAGCCGAGGGAAGG - Intronic
1092198230 12:6563070-6563092 GACCTTGCACAGGTGAGGGGTGG - Exonic
1093433349 12:19108034-19108056 GCGCTGGGCCAGCTCCGGGGAGG + Intergenic
1095098502 12:38160217-38160239 TCCCTGGCCCGGCGCAGGGGTGG - Intergenic
1096773404 12:53950345-53950367 GGCCCGGCCCAGCTCTGGGGAGG - Intergenic
1096814896 12:54195848-54195870 GCGCCTGCTCAGCTCAGGGTGGG - Intergenic
1100823055 12:98449611-98449633 GCCCTTACCCAACTCAGGATAGG - Intergenic
1101123534 12:101608221-101608243 GCCCTTGCCCAGGAAAGAGGGGG + Intronic
1101255694 12:102974429-102974451 GCAAATGCCCAGCTCATGGGTGG - Intergenic
1102580379 12:113882659-113882681 GCCCATGCCGAGCCCAGGGGTGG + Intronic
1102900347 12:116631754-116631776 GCCCTTGCCCCTCCCAGGTGGGG + Intergenic
1104590695 12:130082238-130082260 GCCGGTGCCCAGCCCAGGGCAGG - Intergenic
1104857066 12:131907362-131907384 GCACCTGCCCAGCCCAGGGCAGG - Intronic
1105029456 12:132872725-132872747 GCACAAGTCCAGCTCAGGGGAGG - Intronic
1105714789 13:23052383-23052405 TCCCTTGGCAAACTCAGGGGAGG + Intergenic
1106607316 13:31241252-31241274 GGGCTTCCCAAGCTCAGGGGAGG + Intronic
1109627203 13:64991634-64991656 ACCCTGGCCCAGCCCAGTGGAGG - Intergenic
1115505838 14:34093291-34093313 ACCCTTCCCCAGCCCAAGGGTGG - Intronic
1118321267 14:64754679-64754701 GCCCCTGCCCAAGTCAAGGGAGG + Intronic
1121451559 14:94011450-94011472 GCCCCAGCCCTGCCCAGGGGAGG - Intergenic
1121526959 14:94625770-94625792 TCACTTGCCCATCCCAGGGGAGG - Intergenic
1121616649 14:95318457-95318479 GTCCTTGCCCAACCTAGGGGTGG + Intronic
1122131930 14:99609315-99609337 GCTCTTGCAAAGCTCTGGGGAGG + Intergenic
1122249064 14:100425328-100425350 TCCAGTGCCCAGCACAGGGGTGG + Intronic
1122263311 14:100535280-100535302 GCCTTGGCCCAGATCTGGGGGGG - Intergenic
1122531651 14:102431997-102432019 GCCCTTGCCCAGCTCAGGGGTGG - Exonic
1122543783 14:102511301-102511323 GCCCTGCCCCACCTCAGGGCGGG + Intergenic
1122807379 14:104266742-104266764 GCCCCTGCCCACCTCTGGGAGGG - Intergenic
1123014072 14:105365249-105365271 GGGAGTGCCCAGCTCAGGGGTGG + Intronic
1123989548 15:25673246-25673268 GCCCCTGCCCAGCGCATAGGGGG - Intergenic
1124404147 15:29379307-29379329 GCCCCTGTCCAGGTCAGGCGTGG - Intronic
1125554648 15:40573957-40573979 GTCCTTGCCCAACTCTGAGGAGG - Exonic
1125725710 15:41867156-41867178 GCCCTGCCCCAGCCCAGGGTGGG - Intronic
1125730669 15:41891144-41891166 CCCCTTGCCCTGCTCAAGTGAGG + Intronic
1125733055 15:41904898-41904920 GGCCTGTCCCAGCTCAGGGAAGG + Intronic
1128207887 15:65869379-65869401 GCCCTTGTTGGGCTCAGGGGCGG + Intronic
1128280543 15:66390511-66390533 GCCCTTACCCAGTTCAGAGATGG + Intronic
1128731954 15:70027200-70027222 GCTTATGCCCACCTCAGGGGTGG - Intergenic
1128793050 15:70447263-70447285 GTCCTGGCCCAGTTCAGGGTAGG + Intergenic
1129868656 15:78927245-78927267 GCCCATGCACAGCTTAGGGAGGG - Intronic
1129882606 15:79017031-79017053 GCCCTTGCTGGGCTCAGGGAGGG + Intronic
1131341753 15:91608879-91608901 GCCTGTGCCCTGCTCAGGTGTGG - Intergenic
1132570686 16:642633-642655 GCCCTTGCAGAGCTCAGTGGGGG + Intronic
1133102607 16:3488335-3488357 GCCCCAGGCCTGCTCAGGGGTGG + Intergenic
1133371948 16:5252028-5252050 GCACTTCCCCAGCTCAGCGGGGG - Intergenic
1134362593 16:13545526-13545548 GCCTTTCCCATGCTCAGGGGTGG - Intergenic
1135081895 16:19443616-19443638 GCCCATGCCTAACTCAGGGTTGG + Intronic
1135459507 16:22629139-22629161 CACCATGCCCAGCTCAGGGTTGG - Intergenic
1136464045 16:30429850-30429872 GGCCTGGCCCAGCTCGGGGTGGG - Intronic
1138549934 16:57741938-57741960 GCTGGGGCCCAGCTCAGGGGTGG + Intronic
1139437501 16:66944844-66944866 GCCCATCCACAGCTCAGTGGGGG - Exonic
1139516918 16:67457725-67457747 GCCCTTGCTGAGCCCAGGAGTGG - Intronic
1140476829 16:75243154-75243176 GCTCCTGCCCTGCTCTGGGGAGG + Intronic
1140513921 16:75529002-75529024 GTCCTTGCCTACTTCAGGGGAGG + Exonic
1141247113 16:82318262-82318284 GTCCTTGCCCAGTTCCTGGGAGG + Intergenic
1142594627 17:1023461-1023483 GCCCTGCCCCAGCCCAGGGCAGG + Intronic
1142848115 17:2691884-2691906 GTCCTCGCCCAGCTGCGGGGAGG + Exonic
1143009250 17:3856942-3856964 GCCCTTTCTCAGCTTTGGGGTGG + Intergenic
1143030173 17:3963516-3963538 GGCCTTTCCCATCTCTGGGGAGG - Intronic
1143300151 17:5902820-5902842 GCCCAAGCCCAGCCCTGGGGAGG - Intronic
1144707829 17:17381015-17381037 GCCTTTGCCAAGCTCAAAGGAGG + Intergenic
1144802547 17:17940467-17940489 GCCCCCACCCAGCTCAGGGATGG + Intronic
1146763743 17:35500435-35500457 GCGCCTGGCCAGGTCAGGGGTGG - Intronic
1148158585 17:45437228-45437250 GGCCCTGCCCTGCTGAGGGGCGG + Exonic
1148159168 17:45440330-45440352 GCCCCTGCCCCGCCCAGGCGGGG - Intronic
1148163058 17:45462554-45462576 GCCCTAACCCAGCTAGGGGGTGG - Intronic
1148776040 17:50096201-50096223 GCCCCTGCCCAGCTGGGGAGAGG - Intronic
1148953773 17:51336722-51336744 GCCCTTGCAGAGCTCACTGGAGG + Intergenic
1149658515 17:58322850-58322872 ACCCTACCCCTGCTCAGGGGTGG + Intronic
1150239583 17:63621651-63621673 GCTCTTGCCCCGGGCAGGGGCGG - Intergenic
1150390006 17:64784629-64784651 GGCCCTGCCCTGCTGAGGGGCGG + Intergenic
1150394287 17:64809209-64809231 GCCCTAACCCAGCTAGGGGGTGG - Intergenic
1150489398 17:65563897-65563919 GCCCTGGGCCAGCTCAGAGCTGG - Intronic
1151385045 17:73750053-73750075 GCCCTTGTCCAAGTCAGGGAGGG + Intergenic
1152244293 17:79177167-79177189 GCCTTGGGCCAGCTCTGGGGAGG - Intronic
1152548987 17:81019921-81019943 GCCTTTTCCCAGGTCCGGGGTGG + Intergenic
1152616732 17:81341396-81341418 GTCCTTCCCCAGCTCTGCGGGGG + Intergenic
1152879075 17:82805123-82805145 GGCCTTGCTCAGCGCAGGGCTGG + Intronic
1154197258 18:12275702-12275724 ACCCTGGCCCACCTCAGGTGAGG - Intronic
1157552053 18:48588794-48588816 ACCCTTCCCCATCTCAGGAGGGG + Intronic
1160246978 18:77166743-77166765 CCCCTTCCCCTGCTCAGGTGAGG + Intergenic
1160519379 18:79495214-79495236 TCCCGTGCCCACCTCAGGGAAGG - Intronic
1160681024 19:411658-411680 ACCCCTGCCCAGCCCAGGTGGGG + Intergenic
1160844341 19:1159895-1159917 GCCACTGCCCAGCTCTGTGGGGG - Intronic
1160968727 19:1758015-1758037 GCGCTTGCCCGGCTCGGGGCGGG + Intronic
1160992346 19:1864858-1864880 GCCCCTTCCCAGCTCCGGCGGGG + Intergenic
1161271614 19:3392750-3392772 GCCCTCGCCCAGCTGGAGGGAGG - Intronic
1161532940 19:4800989-4801011 CTCCTGGCCCAGCACAGGGGCGG - Exonic
1162059701 19:8087086-8087108 GCCCCTGCCTGGCTCTGGGGAGG - Exonic
1164454725 19:28397653-28397675 GCCATTGCTCAGCCAAGGGGTGG + Intergenic
1164732844 19:30519207-30519229 CCCCCAGCCCAGCTCTGGGGTGG + Intronic
1164783465 19:30911815-30911837 GCCCTGGCCCAGGGCAGGTGTGG + Intergenic
1164846855 19:31439721-31439743 GCCCTTCCCCAGCTAGGGGCTGG - Intergenic
1165170403 19:33888092-33888114 CCCCTCGCCCAGCTCAGGGTTGG + Intergenic
1165434161 19:35787560-35787582 GTCAGTGCCCAGCTCAGGGCAGG + Exonic
1165941571 19:39417082-39417104 GGCCTTGCCCAACTCGTGGGGGG - Intronic
1166367778 19:42286009-42286031 CCCCTTGCCCAAAACAGGGGAGG - Intronic
1166932972 19:46312497-46312519 GCCCTTGCTCAGCACTGAGGAGG - Exonic
1167277017 19:48545012-48545034 GCCCCAGCCCAGCTCAGGGCAGG + Intergenic
1167439468 19:49500034-49500056 GCCCATGCCCACAGCAGGGGGGG - Intergenic
1167632702 19:50635519-50635541 GCCCTTGATCAGCTCCCGGGAGG + Intronic
1168239868 19:55083653-55083675 CCCCTTGCCCTGCCCTGGGGCGG - Intronic
924965135 2:69579-69601 GCCCTGGCCCTGCTGAGGGCAGG - Intergenic
925668811 2:6290201-6290223 GACAGTGCCCAGCTCAGTGGGGG - Intergenic
925971729 2:9110995-9111017 CCCTTTGCCCAGCTCAGTGAAGG + Intergenic
926718777 2:15943268-15943290 TCTCTGGCCCAGGTCAGGGGAGG + Intronic
927000070 2:18785803-18785825 GCCCTTGCCCTGTTCAGTTGGGG + Intergenic
928391525 2:30914501-30914523 CCCCTTGCCAAGGTCTGGGGTGG + Intronic
928396710 2:30948302-30948324 GCCCTTGCCCAGCTCCTGGGAGG + Intronic
928877546 2:36057703-36057725 GCCATGGCCAAGCTCAGGAGTGG + Intergenic
929069994 2:38020454-38020476 GGCCTTGGCCAGCTCAGGAAGGG - Intronic
930035489 2:47082878-47082900 TCCCATGCCCAGCCCAGGAGGGG + Intronic
930176128 2:48303199-48303221 GCCCTTGCACTTCTCAGGTGAGG + Intergenic
930724614 2:54670531-54670553 GCCCTTGCCATGCTCAGGGTTGG + Intronic
932492430 2:72130931-72130953 TGCTTAGCCCAGCTCAGGGGTGG - Exonic
936092565 2:109510708-109510730 GCCCTTCCCCAGCCCAGGCTGGG - Intergenic
937638434 2:124184295-124184317 GCCCCTCCCCAGCTTTGGGGTGG + Intronic
941905944 2:170716275-170716297 GTGCTTGCCCAGGTCCGGGGAGG - Exonic
942757919 2:179363918-179363940 GTCTTTCCCTAGCTCAGGGGTGG - Intergenic
944428092 2:199604198-199604220 GCCATTGCTCAGCGCAGGGCAGG - Intergenic
946397279 2:219449257-219449279 GGCCTTACCGAGCTCAGGGGAGG - Exonic
948074997 2:235159017-235159039 GACCCTGCCCTGCTCAAGGGTGG - Intergenic
948691624 2:239707764-239707786 GCCCTTCCCCAGGGCAGGGCAGG - Intergenic
1171372163 20:24668906-24668928 GCCCTGTCCCAGCTCTGGAGGGG - Intergenic
1172011405 20:31848212-31848234 CCCCATGCCCAGCTGGGGGGCGG + Intronic
1172903984 20:38355432-38355454 GCCCTCGCCAAGCTCGGGGGAGG - Intronic
1173810636 20:45953092-45953114 GCCCTTGGCCAGCACCTGGGCGG - Intronic
1175773265 20:61636887-61636909 GCCCTGGTGCAGCTCAGGGAGGG - Intronic
1175985978 20:62764366-62764388 GCACCTGCCCAGCTCAGAGGTGG + Intergenic
1176024511 20:62978853-62978875 GCCCGTGCCCAGCTCCGGAGGGG - Intergenic
1176308220 21:5135475-5135497 GCCCCAGCCCAGCCCAGGAGTGG + Intronic
1176369546 21:6054030-6054052 CCCCCTGCCCAGCCCTGGGGAGG - Intergenic
1179507648 21:41852470-41852492 GGCCTGGCCCAGCACAAGGGAGG - Intronic
1179753973 21:43484511-43484533 CCCCCTGCCCAGCCCTGGGGAGG + Intergenic
1179848840 21:44126557-44126579 GCCCCAGCCCAGCCCAGGAGTGG - Intronic
1180222359 21:46367153-46367175 GCCCTGCCCCAGCCCAGGGCAGG + Intronic
1181043288 22:20202982-20203004 TCCCTTGCCCATCTCAGGACAGG - Intergenic
1181049419 22:20231538-20231560 GCCCCTGCCACGCTCAGGGCTGG - Intergenic
1181119610 22:20657252-20657274 GCTCTTGCCCGGCTTAGAGGAGG + Intergenic
1181368521 22:22398442-22398464 GGACTTGGCCAGCCCAGGGGAGG + Intergenic
1181381499 22:22508381-22508403 GCCCGGGCCCAGCCCGGGGGTGG + Intronic
1181431621 22:22885016-22885038 GCCCTTGCACATCTCAGGGCAGG + Intronic
1181602913 22:23962975-23962997 CCCAGTGCCCAGCACAGGGGTGG + Intergenic
1181605601 22:23978332-23978354 CCCAGTGCCCAGCACAGGGGTGG - Intronic
1182443398 22:30376871-30376893 GCCCCTGCCCAGGACAGGGAAGG - Intronic
1182500230 22:30741316-30741338 GGCCTTGGCCAGCTCCAGGGCGG - Exonic
1183272684 22:36871877-36871899 CCCCGAGCCCAGCTAAGGGGAGG + Intronic
1183697693 22:39432497-39432519 GCCCCTGCCCAGCAGAGTGGAGG - Intronic
1184807169 22:46802761-46802783 GTCCTTGGGCAGCTCATGGGAGG + Intronic
1185399775 22:50609798-50609820 CCCCTTGCCCAGCTCCGAGGTGG - Intronic
950128343 3:10524952-10524974 TCCCATGCCCAGCACAGGGGTGG - Intronic
950471869 3:13191288-13191310 GCCTGTGCCCAGCTCTGGAGAGG - Intergenic
950580451 3:13858523-13858545 GCCCTTCCCCACCTCAGGGGTGG - Intronic
950703836 3:14768112-14768134 CCCCTTGCCCACCTCAGAAGAGG + Intronic
950704100 3:14769502-14769524 CCCCTTGCCCACCTCAGAAGAGG + Intronic
950826690 3:15830689-15830711 GCCCTTGCTCAGCTCCTAGGAGG + Intronic
952539517 3:34352914-34352936 GCCATTGCCTTGCTCAGGAGTGG + Intergenic
952962631 3:38602318-38602340 GCCCTGGCCCATCTGAAGGGTGG - Intronic
953414027 3:42705383-42705405 AACCTTGCCCAGCTCAGCTGTGG + Intronic
954629762 3:52041433-52041455 ACCCTCCCCCAGCTCAGAGGAGG + Intergenic
954671115 3:52291869-52291891 GCCCTGTCCCAGCTCAAGGGTGG + Exonic
955062544 3:55505821-55505843 GCCCTCTCCCACCTCAGGGTTGG + Intergenic
955167012 3:56524974-56524996 GGCCTGGCCCAGCCCAGGGATGG + Intergenic
956168837 3:66416961-66416983 GCCCCTGCCCTGCTCAGGGAAGG + Intronic
956450515 3:69370385-69370407 ACCCGTGCCCAGCCCAGGGCGGG - Intronic
957071057 3:75568194-75568216 GCACTTCCCCAGCTCAGCGGGGG + Intergenic
957830081 3:85505095-85505117 GGCCTTGGCCAGCCCAGGAGGGG + Intronic
960080286 3:113533444-113533466 GCCCTTGACCAGGCCAGGAGAGG - Intronic
960803551 3:121561889-121561911 GGCCCTGCCAAGCTCAGAGGAGG + Intergenic
960811901 3:121634090-121634112 GACCTTGCCTAACCCAGGGGAGG + Intronic
961283058 3:125778530-125778552 GCACTTCCCCAGCTCAGCGGGGG - Intergenic
961438515 3:126936269-126936291 GCCCTTGCAGAGCGAAGGGGAGG + Intronic
961584573 3:127911365-127911387 CCCCTTCCCCAGCTGAGGAGAGG - Intergenic
962649799 3:137477108-137477130 GCCCTTGCTCAGCTCAGGCAGGG - Intergenic
962854353 3:139330385-139330407 GCCCCAGCCCAGCTGAGGGGAGG - Intronic
965710925 3:171555534-171555556 GGCCTTGCCTGCCTCAGGGGTGG + Intergenic
968126498 3:196164057-196164079 ACCCTTGCCCAGTTCAGGAGAGG - Intergenic
968468133 4:763338-763360 GCCATTTCCCAGCGCAGGGCTGG + Intronic
968500460 4:947579-947601 ACCCTTCCCCTGCTCAGTGGCGG + Intronic
968703203 4:2066396-2066418 GCCTCTGCTCACCTCAGGGGCGG - Exonic
968722100 4:2215471-2215493 GACCATGCTCAGCTCAGGGCAGG - Intronic
968952709 4:3702959-3702981 CCCCTTGCCAAGCACGGGGGAGG - Intergenic
969014656 4:4095892-4095914 GCACTTCCCCAGCTCAGCGGGGG + Intergenic
969739284 4:9012549-9012571 GCACTTCCCCAGTTCAGCGGGGG - Intergenic
970545853 4:17129358-17129380 GCCCTTGACCAGCTCCGGAGGGG - Intergenic
971425321 4:26509953-26509975 GCCTTTGACCAGCTCAGCAGTGG + Intergenic
974043168 4:56875517-56875539 GCCCCTGCCAAGCTCATGGCTGG + Intergenic
982968031 4:161940000-161940022 CCCCTTTCCCAGCTCAGCAGTGG + Intronic
985266303 4:188154772-188154794 TCCCTTGCACTGCTCAGGGTGGG + Intergenic
986544790 5:8883719-8883741 CCCTTTGCACAGCTCAGGAGGGG + Intergenic
990510527 5:56485367-56485389 AGCCTTGCCCAGATCAGGGTTGG + Intergenic
995305328 5:110640021-110640043 GCCCTTGCCCAACCCGAGGGGGG - Intronic
996185153 5:120465102-120465124 GCCCTGGGCCAGATCAGGGAGGG + Intronic
996340238 5:122429809-122429831 TCCCTTTCCCAGCTTTGGGGAGG - Intronic
997206556 5:132053698-132053720 GCCCTGGCCCAGCCCTGGAGGGG + Intergenic
997425920 5:133802540-133802562 GCCCTTTCCCAGCTCTGGTAAGG - Intergenic
997622268 5:135306647-135306669 GCCCATGCCCAGCACAGATGAGG - Intronic
997980937 5:138467011-138467033 GGCACTGCGCAGCTCAGGGGTGG - Exonic
999133389 5:149301193-149301215 GCTCTTGGCTAGCTCAGGGCTGG - Exonic
1001325557 5:170721213-170721235 GCCCCTACCCAGATCAGGTGGGG + Intronic
1002103918 5:176870579-176870601 GGCCTTGCCCAGCCCTGGGGAGG + Intronic
1002860656 6:1076690-1076712 GCCCTCCCACAGCTCATGGGAGG + Intergenic
1003082956 6:3037136-3037158 GCCACTGCCCAGGTCAGGTGAGG + Intergenic
1003137880 6:3446861-3446883 GCCCTTAGCCAGCTGAGGTGAGG - Intronic
1003181896 6:3799365-3799387 GCCCATGCCCTGCCCTGGGGTGG + Intergenic
1003589555 6:7425724-7425746 GGCCTTGGCCAGCTCAGGAAGGG - Intergenic
1004354026 6:14915931-14915953 GCCCTCGGCCAGCTCAGAGAGGG - Intergenic
1004663258 6:17728702-17728724 GGCCTTGGCCAGCCCAGAGGGGG - Intergenic
1006337463 6:33428057-33428079 GCCCTTCCCCCGCGCAGGGGCGG + Intronic
1006610384 6:35291133-35291155 GCCCCTGCCCAGGGCAGGGGTGG + Intronic
1006873703 6:37276981-37277003 GCCGTTAACCAGCTGAGGGGTGG - Intronic
1008266475 6:49433513-49433535 TCCCTGGCCCAGCTAAGTGGAGG - Intronic
1008536843 6:52512659-52512681 GGCCTTGCTTAGCTCATGGGTGG - Intronic
1008572599 6:52829604-52829626 GGCCTTGGCCAGCCCAGGGAGGG + Intergenic
1009914319 6:69974343-69974365 GCACTTGTCCAGCCCTGGGGAGG + Intronic
1011879983 6:92012161-92012183 GGCCTTGGCCAGCCCAGGGAGGG + Intergenic
1013742178 6:113300299-113300321 GCCCTTACCTAGCTCCTGGGAGG + Intergenic
1014769407 6:125444492-125444514 CGCCTTGCCCAGGTCAAGGGAGG + Intergenic
1016468284 6:144348243-144348265 GCACACGCCCAGCTCTGGGGAGG + Intronic
1017717499 6:157222887-157222909 GCCTTTGCCCAGCTCGGAGCTGG + Intergenic
1018845626 6:167553380-167553402 GCTCTCTCCCAGCTCTGGGGTGG + Intergenic
1018899809 6:168045382-168045404 GCACCTCCCCAGCTCACGGGTGG - Intergenic
1019040100 6:169096629-169096651 GCCCTTTCCCAGCTGTGGAGGGG + Intergenic
1019294441 7:266499-266521 GCCCTTCCCCACCTCCTGGGGGG + Intergenic
1019615276 7:1956602-1956624 GCCCTGGCAGAGCTCAGGAGAGG + Intronic
1019635172 7:2071618-2071640 CTCCTTCCCCAGCTTAGGGGTGG - Intronic
1019713706 7:2529030-2529052 GCCCCGACCCCGCTCAGGGGTGG + Intronic
1019773190 7:2896497-2896519 GCCCATGGCCAGCTCACGGTGGG - Intergenic
1020067277 7:5198195-5198217 GCCATGGCACAGCACAGGGGTGG + Intronic
1026104958 7:67413567-67413589 GGCCCTGCCCAGCTCAGGCTTGG - Intergenic
1026929455 7:74215804-74215826 GTCCTTGCCCAGTGCAGGAGCGG + Intronic
1029073332 7:97917521-97917543 GCACTTCCCCAGCTCAGCCGGGG + Intergenic
1030367071 7:108657634-108657656 GACCTTGGCCAGCTCAGGAAGGG + Intergenic
1032083548 7:128872180-128872202 TCCATTGCCCAGCTGAAGGGTGG + Intronic
1032337768 7:131042387-131042409 TCCATGGCCCAGCTCTGGGGGGG - Intergenic
1034274995 7:149820107-149820129 GCTCTTTCCCACCTCGGGGGTGG - Intergenic
1034498112 7:151433885-151433907 GCCCTTCCCCAGGTGAGGGTAGG + Intronic
1035233467 7:157480884-157480906 GTCCTGCCCCAGCTCAGGGAGGG + Intergenic
1035297241 7:157874049-157874071 GGCCTGGCACAGCTCAGTGGTGG + Intronic
1041662392 8:60412894-60412916 TCCCTTGCCCAGCACTGGGCAGG - Intergenic
1045912015 8:107421538-107421560 TTCCTTTCCTAGCTCAGGGGAGG - Intronic
1046048049 8:108986826-108986848 CCCCTTGCCCTTCCCAGGGGAGG + Intergenic
1047310748 8:123689711-123689733 GCCCGGGCCAAGCTCAGGGCAGG + Intronic
1047392559 8:124465264-124465286 GCCTTTGCCCAGCTCATGATGGG - Intergenic
1049066477 8:140320465-140320487 CCCCTAGCCCCACTCAGGGGAGG + Intronic
1049206648 8:141366711-141366733 GCCCTGCCCCAGCTGCGGGGTGG + Intronic
1049601177 8:143508350-143508372 GCCTGTGCCCTGCACAGGGGAGG + Intronic
1050388090 9:5111460-5111482 GTACCTGCCCAGCTCAGGTGAGG + Intronic
1050625532 9:7500076-7500098 GAGGTTGCACAGCTCAGGGGAGG + Intergenic
1052313379 9:27092596-27092618 GGCCTTGGCCAGCCCAGGAGGGG - Intergenic
1055762707 9:79626158-79626180 CCCCTTACACAGCTCAGAGGTGG + Intronic
1056404604 9:86261692-86261714 GCCCTTGCCCCGCTAAAGGTTGG + Intergenic
1056793168 9:89639290-89639312 ACCCTTGCCAAGATCAGGTGGGG + Intergenic
1057699041 9:97349687-97349709 GCACTGGCCCAGCTCAGTGTAGG + Intronic
1057804227 9:98209182-98209204 GCCCTTCCCTAGATAAGGGGTGG + Intronic
1060516260 9:124267663-124267685 CCCAGTGGCCAGCTCAGGGGCGG - Intronic
1060596299 9:124851150-124851172 GCCCCTGCCCAGCTTAGAGCTGG + Intergenic
1060597003 9:124854398-124854420 ACCCGTGCCCAGCTCATCGGAGG - Intronic
1060951769 9:127608528-127608550 GTGCTGGCCCAGCGCAGGGGTGG - Intergenic
1061289328 9:129641853-129641875 GGCCTCGGCCAGCTCACGGGAGG + Intronic
1061572205 9:131484797-131484819 GCCCTCACCCAGCTCAGGGCTGG - Intronic
1061614831 9:131772894-131772916 CCACTTGCCCAGCTCAGGAAGGG - Intergenic
1061824441 9:133248963-133248985 GCCCTTCCGCAGCTCCTGGGGGG + Intergenic
1062379144 9:136278420-136278442 GGCCGTGCCCAGCTCGGGGACGG - Intergenic
1062511247 9:136907355-136907377 GCCTCTGCCCAGCTCCTGGGTGG + Intronic
1062620126 9:137416875-137416897 TCCCGAGCCCAGCTCAGGGAGGG - Intronic
1062656304 9:137605867-137605889 GCCCTGGCCCCGCGCAGGTGCGG - Intronic
1203773017 EBV:58976-58998 GACCTCGTCCAGCTCAGGGCGGG + Intergenic
1186518329 X:10183952-10183974 TCCCTTGTCCAGCTCCAGGGTGG + Intronic
1187716585 X:22108170-22108192 GCCCTTGCCCATCTCTGTTGAGG - Intronic
1192227497 X:69239107-69239129 GCCCTTGCCAAGCTGAGTGGAGG + Intergenic
1195554094 X:106201624-106201646 GCCCCTGCCTGGATCAGGGGAGG - Intronic
1198389058 X:136155263-136155285 GCCCTGGCCCAGCCCAGGGTGGG - Intronic
1199659067 X:150029136-150029158 GCCCTTCCCCAGCTCAGATAAGG + Intergenic
1200133860 X:153865241-153865263 GTCCTCGCCCAGGTCTGGGGAGG + Intronic