ID: 1122531670

View in Genome Browser
Species Human (GRCh38)
Location 14:102432139-102432161
Sequence TAGCTGGCACACACCCATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 106}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122531664_1122531670 27 Left 1122531664 14:102432089-102432111 CCTATCAAAGTGAAAAGGAAGAA 0: 1
1: 0
2: 5
3: 53
4: 560
Right 1122531670 14:102432139-102432161 TAGCTGGCACACACCCATCTGGG 0: 1
1: 0
2: 0
3: 11
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122531670 Original CRISPR TAGCTGGCACACACCCATCT GGG Intronic
902906753 1:19563906-19563928 TTGCAGGCACACACCCGTTTGGG + Intergenic
908389285 1:63670368-63670390 TAGCTGGCCGCCAGCCATCTGGG - Intergenic
916063656 1:161119175-161119197 TACCTGGCACACAGCCACCAGGG - Exonic
917472664 1:175338924-175338946 TTGCTGCCACACACCCGTCGAGG + Intronic
917632480 1:176903929-176903951 TAGCTGCCTCACACTAATCTTGG + Intronic
919529725 1:198701925-198701947 TTGCAGGCACACACCTCTCTGGG - Intronic
921117564 1:212108193-212108215 TAACTGGCACAAACCCATGAAGG - Intergenic
923895618 1:238266944-238266966 AAGCTGGCAGCCACCCTTCTGGG + Intergenic
1063914446 10:10867249-10867271 GAGCTGGCTCACACCCACCTGGG - Intergenic
1069274120 10:66567800-66567822 GAGCTGGCATCCATCCATCTTGG + Intronic
1070416057 10:76190575-76190597 CTGCTACCACACACCCATCTGGG - Intronic
1070918610 10:80170392-80170414 TACCTGCCACACACCCACCAAGG + Intronic
1076251380 10:128986456-128986478 TAGCTGCCACACACCCAGGCTGG - Intergenic
1078893799 11:15580348-15580370 AAGCTGGCACATACACAGCTAGG - Intergenic
1082687771 11:56260690-56260712 TAGTTTGCACACACCTACCTGGG + Intergenic
1087211130 11:95447127-95447149 GGGCAGGCACACACCCAGCTGGG + Intergenic
1090953752 11:131496733-131496755 TGGCAGCCACACACCCATTTGGG - Intronic
1091719343 12:2801256-2801278 CTGCTGGCACACAGCCAGCTGGG - Exonic
1091954467 12:4626919-4626941 TATCTGGCTGACAGCCATCTTGG + Exonic
1093577938 12:20756017-20756039 TGGCTTGCACACACCCACATTGG - Intergenic
1095231009 12:39740020-39740042 TAGCTGCCACACAGCCAACATGG + Intronic
1100976002 12:100123213-100123235 TATGTGGCAGACACCAATCTGGG + Intronic
1102524368 12:113500691-113500713 TAGCTCCCAAAAACCCATCTGGG - Intergenic
1114953735 14:27791474-27791496 ATGCTGACACACACACATCTAGG + Intergenic
1118312196 14:64702610-64702632 TAGTAAGCACACACCCATCTAGG + Intergenic
1118960275 14:70523675-70523697 TAGCTCGCACACACACCACTGGG + Exonic
1122531670 14:102432139-102432161 TAGCTGGCACACACCCATCTGGG + Intronic
1123007421 14:105330543-105330565 GAGCGGCCACACACCCAGCTGGG - Intronic
1126352817 15:47762849-47762871 AAGCTTGAACACACCCATATTGG + Intronic
1129851861 15:78798096-78798118 GAGCTGGAACACACCTTTCTGGG + Exonic
1131121975 15:89828477-89828499 TAGCCAGCCCACACCCAGCTGGG + Intergenic
1132749132 16:1449262-1449284 GAGCTGGGACATACCCAGCTGGG + Exonic
1135648074 16:24180979-24181001 CAGCTCTCACACAGCCATCTGGG - Intronic
1137273430 16:46918053-46918075 CAGCTGGCAGACACCCACCCTGG - Intronic
1142362124 16:89632440-89632462 TAGCGGGCACACAGCCATTTGGG - Intronic
1144613993 17:16751862-16751884 TAGCTCGCACTCACCCAACCAGG + Intronic
1144898719 17:18563809-18563831 TAGCTGGCACTCACCCAACCAGG - Intergenic
1145005203 17:19333684-19333706 TGCCAGGAACACACCCATCTCGG - Intronic
1145133656 17:20381914-20381936 TAGCTGGCACTCACCCAACCAGG + Intergenic
1147217251 17:38908123-38908145 AAGCTGTCACACATTCATCTGGG + Intronic
1157725951 18:49963920-49963942 TGGATGGAACACACCCCTCTGGG - Intronic
1158092027 18:53726124-53726146 AAGCTGGCACAAACACATTTAGG + Intergenic
1159107419 18:64018970-64018992 TAGTTGGCACTCATGCATCTGGG - Intergenic
1160413308 18:78689098-78689120 CCGCTGGCACAGAGCCATCTTGG + Intergenic
1161308284 19:3578956-3578978 AAGCCGGCCCCCACCCATCTGGG - Exonic
1162386427 19:10362742-10362764 TAGAGGGCACACACACAGCTAGG + Intronic
925198898 2:1950491-1950513 TCCCTGTCCCACACCCATCTTGG - Intronic
927613625 2:24566769-24566791 TCGTTGGCACCCACCCAGCTGGG + Intronic
928840431 2:35598899-35598921 AAGCATGCACACACCCATCTGGG - Intergenic
930668408 2:54122568-54122590 TGGCTGGAACACAGCCCTCTTGG - Intronic
934483535 2:94677498-94677520 ATGCTGACACACACACATCTAGG - Intergenic
939161262 2:138592556-138592578 TAGATGGTACCCACCCATATTGG + Intergenic
942361639 2:175179206-175179228 TAGCTGAGACACACCATTCTGGG + Exonic
944034856 2:195282205-195282227 AACCTGGGACACATCCATCTTGG + Intergenic
944821803 2:203440045-203440067 TTGCTGACACACACCCTTGTTGG + Exonic
946229102 2:218280649-218280671 GAGCTGGCTGACACCCCTCTGGG + Intronic
948992634 2:241562554-241562576 GAGCTGGCCCCCACCCATCCTGG + Intronic
949081200 2:242101237-242101259 GAACTGACACACACACATCTTGG - Intergenic
1169878437 20:10322489-10322511 GAGCTGCCACCCACCCATGTAGG + Intergenic
1173207670 20:41007389-41007411 AAGCATGCACACACCCAGCTGGG + Intergenic
1175186250 20:57181170-57181192 GAGCTGGGACACAACCATCTGGG - Intronic
1175537460 20:59724837-59724859 TACCTGGCACACAGCCACCAGGG - Intronic
1175841897 20:62033255-62033277 TTCCTGCCACACACGCATCTTGG - Intronic
1177472248 21:21573904-21573926 TCGCTGACCCACCCCCATCTTGG - Intergenic
1178183862 21:30196778-30196800 TTGCTGGCAAATACCCATCTTGG + Intergenic
1178405165 21:32317540-32317562 GAGATGGGACACATCCATCTTGG - Intronic
1179407298 21:41136561-41136583 GAGCATGCACACACCCAGCTGGG - Intergenic
1179410473 21:41159284-41159306 TAGCGGGCACACTCCCCTTTGGG + Intergenic
1179950897 21:44708340-44708362 TCGCTGGCACACAGCCTTCCAGG + Intronic
1180819290 22:18814593-18814615 TAGGTGCCACACACCGTTCTAGG - Intergenic
1181205516 22:21249037-21249059 TAGGTGCCACACACCATTCTAGG - Intergenic
1182353744 22:29712919-29712941 GGGCTGTCACACACACATCTAGG + Intergenic
1183663360 22:39234107-39234129 TCCCTGCCACACACCCTTCTAGG + Intronic
950312050 3:11967301-11967323 TAGATGACACCCACCCATATTGG - Intergenic
953124767 3:40080263-40080285 TTCCTGGCACAAACCCAGCTTGG + Intronic
953512379 3:43555275-43555297 TACCTGCCACACACCAATATTGG + Exonic
958722417 3:97860589-97860611 CATCAGGCACACACCCACCTTGG - Intronic
958980133 3:100710011-100710033 TAGCTGGCGCACTCCCCTCCCGG - Intronic
962193462 3:133335980-133336002 TAGCCGACACCCACCCATCAAGG + Intronic
965380650 3:167983448-167983470 TAGCTAGCACTCACCCTTCAGGG - Intergenic
967120710 3:186380391-186380413 TAGATGGCACCCACCCACATTGG + Intergenic
976353601 4:84088326-84088348 TAAAGTGCACACACCCATCTGGG - Intergenic
976465746 4:85366927-85366949 AAGCTGGCACCCACCTCTCTTGG + Intergenic
979218433 4:118193588-118193610 CTGCTGGCACACAGCCAGCTGGG + Intronic
979848091 4:125542757-125542779 TAGGTGTCACGCACCCACCTGGG + Intergenic
980009681 4:127581351-127581373 TCCCTGGCACACACACCTCTAGG + Intergenic
981316428 4:143344240-143344262 GAGCTGGCACTCACACAGCTGGG - Intronic
983953000 4:173663815-173663837 TGGTAGGCACACACCCTTCTAGG + Intergenic
986236896 5:5919472-5919494 TAGCTGCAACACAGTCATCTTGG - Intergenic
987116190 5:14728639-14728661 TAGCTGTCACTCAGCCCTCTTGG - Intronic
993187130 5:84635449-84635471 GAGCCTGCACACACCCAGCTGGG + Intergenic
993981153 5:94545130-94545152 CAGCTGGCACCCACCCATGGAGG + Intronic
994692442 5:103034959-103034981 TAGCATGCACACACCCAGCCAGG + Intergenic
994917964 5:106004252-106004274 CATCTGGCAGACACCCCTCTAGG - Intergenic
999413975 5:151378838-151378860 TGGCTGGCACACAGCCACCTGGG + Intergenic
1002711430 5:181197481-181197503 TACCAAGCACACACCCATCCCGG - Intronic
1003580014 6:7331548-7331570 TAGCTGAGACACACCATTCTGGG + Intronic
1005883372 6:30076114-30076136 TGGCTGGCACACCTACATCTGGG + Intergenic
1007676991 6:43604318-43604340 TAGCAAGCACACACACATTTTGG + Intronic
1008105913 6:47440983-47441005 TTGCTGGAACACACCTATGTAGG - Intergenic
1016367235 6:143332636-143332658 TATCTGGCACAGACTCACCTAGG + Intronic
1023847634 7:44131599-44131621 TAGCTGGCACACAGCCTCCTGGG - Intergenic
1026550981 7:71368123-71368145 GAGCGTGCACACACGCATCTTGG + Intronic
1026976905 7:74504453-74504475 GAGCTGACACACAGCCAACTGGG - Intronic
1032593459 7:133215123-133215145 TATCTGGCACCCACCCCACTAGG - Intergenic
1035285772 7:157805966-157805988 CAGCTGGCACAAAACCACCTGGG - Intronic
1037301247 8:17454145-17454167 TAGCTGACACACACGCAGCGTGG + Intergenic
1042588516 8:70370438-70370460 TAGCTGCCACAAACCCATGATGG - Intronic
1042855821 8:73266243-73266265 TAGCTGGCAGGCAGCCTTCTGGG + Intergenic
1043710906 8:83418009-83418031 TAGCTGGCATACATCCCACTCGG + Intergenic
1044905100 8:96992054-96992076 TTGCTGCCACACACCCATCAAGG - Intronic
1044998500 8:97859655-97859677 TAGCTTGGACATCCCCATCTAGG - Intergenic
1046617558 8:116494304-116494326 TAGCTCCCACACACACTTCTGGG - Intergenic
1049509420 8:143019872-143019894 AATCTGGAACACACCCAGCTGGG - Intronic
1056191102 9:84185075-84185097 TTTCTGGCTTACACCCATCTTGG + Intergenic
1188437598 X:30179886-30179908 TAACTGTAACACACTCATCTGGG + Intergenic
1189865395 X:45322087-45322109 AAGCTTGCCCACATCCATCTGGG + Intergenic
1190429160 X:50361657-50361679 GAGCTGACAGACACTCATCTAGG + Intergenic