ID: 1122534384

View in Genome Browser
Species Human (GRCh38)
Location 14:102451981-102452003
Sequence CAACTCGGTGCCCTGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 183}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122534384_1122534391 28 Left 1122534384 14:102451981-102452003 CCTCCCTCCAGGGCACCGAGTTG 0: 1
1: 0
2: 0
3: 34
4: 183
Right 1122534391 14:102452032-102452054 TTTCTACATTAAAAATGCTTTGG 0: 1
1: 0
2: 1
3: 45
4: 539
1122534384_1122534389 -5 Left 1122534384 14:102451981-102452003 CCTCCCTCCAGGGCACCGAGTTG 0: 1
1: 0
2: 0
3: 34
4: 183
Right 1122534389 14:102451999-102452021 AGTTGATAGTCTTCTCCTCTTGG 0: 1
1: 0
2: 1
3: 11
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122534384 Original CRISPR CAACTCGGTGCCCTGGAGGG AGG (reversed) Intronic
900338346 1:2175729-2175751 CTCCTCGGGGCCCTGGAGGGTGG - Intronic
900422271 1:2560737-2560759 CAGCTCTGTGCCCTGGGGAGGGG + Intronic
901808105 1:11750394-11750416 CCAGTGGGTGCCCTGAAGGGAGG - Exonic
901988556 1:13093994-13094016 CAACTCGGGGCCCTGGAGCATGG + Intergenic
901993256 1:13132773-13132795 CAACTCGGGGCCCTGGAGCATGG - Intergenic
904000685 1:27336728-27336750 CAACTCTGTACCCCGGCGGGTGG - Intergenic
905885720 1:41490866-41490888 TAACTTGGTGCCCAGGAGGCAGG + Intergenic
910288083 1:85576680-85576702 CAACTCGCTGCCCCGCTGGGAGG + Intronic
912556957 1:110523528-110523550 CCACATGGTGGCCTGGAGGGAGG - Intergenic
918447897 1:184633022-184633044 CAACTCAGTGGCATGCAGGGTGG - Intergenic
920915271 1:210253484-210253506 CCACAAGGTGCCCTGGAGAGAGG + Intergenic
922505014 1:226121454-226121476 CAACTCGGTTCTCTGGCCGGCGG + Intergenic
922774420 1:228208216-228208238 CTGTTCTGTGCCCTGGAGGGTGG + Intronic
1063974541 10:11404858-11404880 CAGATCTGTTCCCTGGAGGGTGG - Intergenic
1067694208 10:48523746-48523768 CAGCCCCGGGCCCTGGAGGGCGG + Intronic
1069147725 10:64917006-64917028 CATCTCTGTGCTCTGGAGGAGGG + Intergenic
1070727172 10:78800335-78800357 CAACTCGGAGGGCTAGAGGGTGG + Intergenic
1072058870 10:91788596-91788618 GAACTCGTTGCCCTGAAGGGAGG + Intergenic
1072569753 10:96648224-96648246 CACCATGGTGCCCTGGAGGCAGG + Intronic
1075441241 10:122480665-122480687 CAGCCCTGTGCTCTGGAGGGAGG + Intronic
1076116444 10:127905121-127905143 CACCTCGGAGCCCAGCAGGGCGG - Intergenic
1076841583 10:133048554-133048576 CAGCTCTGTGGCCCGGAGGGTGG + Intergenic
1082249345 11:49961777-49961799 CAACACTGTGCCCTGGATGTGGG + Intergenic
1083674389 11:64317354-64317376 GACCTCGGTGGCCTGCAGGGCGG + Exonic
1083890487 11:65593352-65593374 CCACGCCGTGCCCTGGAGTGAGG + Intronic
1084171917 11:67405002-67405024 CACCTGGGTAGCCTGGAGGGTGG + Intronic
1084399905 11:68937432-68937454 CAACATGTGGCCCTGGAGGGTGG + Intronic
1090065167 11:123497493-123497515 GAACTTGCTGCCCTGAAGGGAGG - Intergenic
1090515600 11:127423431-127423453 GAACTTGCTGCCCTGAAGGGAGG - Intergenic
1091463587 12:664584-664606 CACCTAGGTGCACAGGAGGGCGG + Intergenic
1092287101 12:7134934-7134956 CAGCTTGGTGCCCTGTGGGGTGG + Intronic
1095506618 12:42905494-42905516 CAACTGGGTGGCCTAGTGGGAGG + Intergenic
1096317504 12:50581362-50581384 GAACTGGTTGCCCAGGAGGGTGG - Intronic
1097175387 12:57139396-57139418 CTACACTCTGCCCTGGAGGGTGG + Intronic
1098775932 12:74617621-74617643 CAAATAGGTACCCTGGAGAGGGG - Intergenic
1098799746 12:74940004-74940026 CATCTCAGTGCCCAGGAGGCAGG + Intergenic
1102541073 12:113619554-113619576 CAACTCTGTGCCCCGGAGCCTGG - Intergenic
1102594520 12:113982166-113982188 CAGTTCTGTGCCCTGGAGGCTGG - Intergenic
1103461466 12:121108160-121108182 GAACTCACTGCCCTGAAGGGAGG + Intergenic
1103904640 12:124321098-124321120 CCACTCTGTGCCCTGGGTGGAGG + Intergenic
1108532914 13:51344300-51344322 CATCTCGGTGCCTTGGCTGGAGG - Exonic
1109095199 13:58105527-58105549 CCACTCTGTGCCTTGTAGGGGGG + Intergenic
1110114933 13:71801764-71801786 CAACTCCTTACCCTGAAGGGTGG - Intronic
1110347713 13:74467552-74467574 CATCTTTGTGCCCAGGAGGGAGG - Intergenic
1111971915 13:94925617-94925639 CAACAAGGTGCCCTAGAGGGAGG - Intergenic
1116624068 14:47242776-47242798 GGACTCGGTGCCCTGGAGCAGGG - Intronic
1117015137 14:51510106-51510128 CATCTTGTTGCCATGGAGGGAGG + Intronic
1117424320 14:55579892-55579914 CCAGGTGGTGCCCTGGAGGGAGG + Intronic
1117678035 14:58174901-58174923 CAACTAAGTGCCCATGAGGGAGG + Intronic
1118747741 14:68786079-68786101 CTACTGGAGGCCCTGGAGGGTGG - Intergenic
1121276209 14:92669621-92669643 CAAATGGGTGCCCTGGGTGGGGG + Intronic
1121731966 14:96193569-96193591 TAGCTCGGTGCCCGGAAGGGCGG + Intergenic
1121830623 14:97048644-97048666 CAAATTGGTGCACGGGAGGGAGG + Intergenic
1122306908 14:100772255-100772277 CCACTCTGCGCCCTGGAGGCTGG - Intergenic
1122534384 14:102451981-102452003 CAACTCGGTGCCCTGGAGGGAGG - Intronic
1122997469 14:105273162-105273184 CACCTCAGAGCCCTGGAGAGAGG - Intronic
1126667858 15:51091243-51091265 CAACACGCTGCAGTGGAGGGTGG - Intronic
1128100310 15:64993177-64993199 CTAATGGGTGCACTGGAGGGAGG - Intergenic
1130930306 15:88421756-88421778 CAAATCAGTGCCCTGTAGGTAGG + Intergenic
1132745237 16:1433671-1433693 CACCTGGGGGCCCTGGTGGGTGG - Intergenic
1133371819 16:5251059-5251081 CACCTCGGTGTCCTGGGGTGGGG + Intergenic
1135965205 16:27029785-27029807 CAACTCTGGCCCCTGGATGGTGG + Intergenic
1138638210 16:58361351-58361373 GAACTCATTGCCCTGAAGGGAGG - Intronic
1140092124 16:71846856-71846878 CTTCTCGGTGACCTGGAGGCAGG + Intronic
1140214341 16:72995310-72995332 AATCTGGGTGCCCTGGAGGACGG + Intronic
1140424745 16:74851363-74851385 CAGCTCGGGGCCCTGCAGGTGGG - Intergenic
1140451340 16:75073326-75073348 CAACACCATGCACTGGAGGGAGG - Intronic
1142251023 16:88992162-88992184 CAACTGGGTACCCTGGAACGTGG + Intergenic
1142328926 16:89437814-89437836 CGTCGAGGTGCCCTGGAGGGTGG - Intronic
1142855121 17:2724789-2724811 CAGCTCGGTGCCCAGCACGGTGG + Intergenic
1143373690 17:6455331-6455353 CGAGTCGGTGCCCTGAGGGGTGG - Exonic
1143512869 17:7405563-7405585 CCACTCGGAGCCCTGGATGGAGG + Intronic
1145289556 17:21532450-21532472 CCTCTCAGTGCCCTGGAGGCAGG - Exonic
1145974695 17:28977401-28977423 CACCTCGGTGCCATGGGGGCAGG - Intronic
1146445414 17:32928453-32928475 CCACTCTGTCCCCGGGAGGGAGG - Intronic
1148028994 17:44607236-44607258 TAACTTGGTGCCATGGAGGGTGG - Intergenic
1151500419 17:74484577-74484599 CACCTGGGGGCCATGGAGGGGGG + Exonic
1151745156 17:76008002-76008024 CACCTCGGGGCCCTGTGGGGAGG - Exonic
1152861851 17:82701009-82701031 AAACTGGGGGCCCTGGTGGGAGG - Intergenic
1153564975 18:6410174-6410196 AAGCTTGGTGCCCTGGAGGAAGG - Intronic
1154334118 18:13452350-13452372 AGACTGGGTGCCGTGGAGGGGGG + Intronic
1157300287 18:46474288-46474310 CAGCTCTGTGCCCAGCAGGGTGG - Intergenic
1157796694 18:50581423-50581445 CACGTGTGTGCCCTGGAGGGAGG - Intronic
1158510428 18:58085437-58085459 CATCTCTGCGCCCTGGAGGATGG + Intronic
1161326283 19:3665755-3665777 CAGCTTGTTGCCCTCGAGGGAGG + Intronic
1161944572 19:7427283-7427305 CTACCCAGTACCCTGGAGGGGGG + Intronic
1164609795 19:29624244-29624266 CAGCCCAGTGCCCTGAAGGGTGG + Intergenic
1164940817 19:32251279-32251301 AGGCTCAGTGCCCTGGAGGGTGG + Intergenic
1164940825 19:32251316-32251338 AGACTCAATGCCCTGGAGGGTGG + Intergenic
1167272422 19:48513514-48513536 CAGCTCGGGGCGCTGGAGGGTGG - Intergenic
1167416292 19:49374837-49374859 CACCAGGATGCCCTGGAGGGCGG + Exonic
1168715907 19:58527183-58527205 CTCCTCGATGCCCTGGAGCGAGG + Intronic
925588622 2:5487868-5487890 AAACTTGCTGCCCTGAAGGGAGG + Intergenic
926383254 2:12312281-12312303 CAACTCTGTGCCCTGGGGTCGGG + Intergenic
926834079 2:16998679-16998701 GAACTTGCTGCCCTGAAGGGAGG - Intergenic
928454317 2:31405403-31405425 AAACAGGGAGCCCTGGAGGGTGG - Intronic
932565147 2:72901479-72901501 CAACTGGATCCCCTGGATGGTGG - Intergenic
933901504 2:86853616-86853638 CAGCTTGGTGTCCTGGAGAGAGG + Intronic
935595163 2:104872540-104872562 GAACTCGGGGACCGGGAGGGCGG - Intergenic
935894301 2:107717893-107717915 CTACTCGGGGCGGTGGAGGGTGG + Intergenic
939530503 2:143354225-143354247 GAACGCGGTTCCTTGGAGGGAGG - Intronic
941420590 2:165279091-165279113 CAACTCAGTGACCTTGAGTGAGG - Intronic
1168968973 20:1917860-1917882 GATCTGGGTACCCTGGAGGGAGG + Intronic
1169520795 20:6370859-6370881 CAACTCTCTGGCCTGGATGGCGG + Intergenic
1169856231 20:10106340-10106362 CAACTCTGTGCCCAGGAGACTGG + Intergenic
1169880406 20:10341235-10341257 CATCCCTGTGCTCTGGAGGGGGG + Intergenic
1171298785 20:24041468-24041490 CAACTCCGTGCCCTCCAGAGAGG + Intergenic
1173058076 20:39635763-39635785 GGACCAGGTGCCCTGGAGGGAGG - Intergenic
1173617299 20:44411471-44411493 CCACTCGGCGCCCTGATGGGTGG + Intronic
1174452298 20:50627951-50627973 CAGCTGTGTGCCCTGGAGTGGGG - Intronic
1175094053 20:56527775-56527797 CAACCCCGGGCCCTGAAGGGTGG + Intergenic
1175575496 20:60057791-60057813 CAAGTTGGTCCCCTGTAGGGAGG + Intronic
1178408145 21:32342252-32342274 CAACCCTGTGTCCTGGAGGCTGG - Intronic
1179494271 21:41761906-41761928 GAACTCGGTGCGCTGGGGAGGGG - Intronic
1179534080 21:42040096-42040118 CAACTCCAGGCCCTGGAGGTTGG + Intergenic
1182129950 22:27843629-27843651 CAGCTTGGTGCCCAGGAGGGAGG + Intergenic
1182289942 22:29268986-29269008 AAACTGGGGGCCCTGGAGGAGGG - Intronic
1183279950 22:36926651-36926673 CTCCTCGCTGCCCTGGAGGAGGG + Intronic
1183718082 22:39545926-39545948 CCTCTCCGTGCCCTGGAAGGTGG - Intergenic
1183951365 22:41354828-41354850 CAAGGCCTTGCCCTGGAGGGAGG + Intronic
1184530601 22:45052833-45052855 CAACTCGATGCAATGGTGGGAGG - Intergenic
1184737369 22:46407091-46407113 CATCTCTGTGCGCTGAAGGGAGG + Intronic
1185056516 22:48581484-48581506 CCACTCGGTGGTCTGGAGGTGGG + Intronic
949749149 3:7330812-7330834 AAACATGGTGCCCTGGAGGAAGG - Intronic
953018470 3:39099362-39099384 TAACTCGCTGCACTGGAGGTGGG + Exonic
953792475 3:45958861-45958883 CAACTTGGTGCCAGGGAAGGTGG - Intronic
953870991 3:46627566-46627588 GGCCTTGGTGCCCTGGAGGGTGG + Intergenic
960672797 3:120168537-120168559 CAACTCATTTCACTGGAGGGAGG - Intronic
961652329 3:128422731-128422753 CAAGGAGGTGCCCGGGAGGGTGG + Intergenic
961746672 3:129068335-129068357 GAACTGGGTGCCCTGGAGCAGGG + Intergenic
966109111 3:176375717-176375739 CAACTCAGTACCTTGGAGAGAGG - Intergenic
968018049 3:195357088-195357110 GAACTCACTGCCCTGAAGGGTGG + Intronic
969193195 4:5540654-5540676 CAAGGGGGTGCCCTAGAGGGAGG + Intergenic
969241555 4:5901986-5902008 CAAATTGCTGCCCTGGTGGGTGG - Intronic
969763750 4:9211894-9211916 CAACTCGGGGGCCTGGAGGCAGG - Exonic
969764354 4:9216642-9216664 CAACTCGGGGGCCTGGAGGCAGG - Exonic
969764959 4:9221389-9221411 CAACTCGGGGGCCTGGAGGCAGG - Exonic
969765568 4:9226133-9226155 CAACTCGGGGGCCTGGAGGCAGG - Exonic
969766180 4:9230878-9230900 CAACTCGGGGGCCTGGAGTCAGG - Intergenic
969766791 4:9235622-9235644 CAACTCGGGGGCCTGGAGGCAGG - Exonic
969767400 4:9240367-9240389 CAACTCGGGGGCCTGGAGGCAGG - Intronic
969768008 4:9245116-9245138 CAACTCGGGGGCCTGGAGGCAGG - Exonic
969768611 4:9249867-9249889 CAACTCGGGGGCCTGGAGGCAGG - Exonic
969769216 4:9254615-9254637 CAACTCGGGGGCCTGGAGGCAGG - Exonic
969769831 4:9259361-9259383 CAACTCGGGGGCCTGGAGGCAGG - Exonic
969770436 4:9264109-9264131 CAACTCGGGGGCCTGGAGGCAGG - Exonic
969771052 4:9268856-9268878 CAACTCGGGGGCCTGGAGGCAGG - Exonic
969772033 4:9326402-9326424 CAACTCGGGGGCCTGGAGGCAGG - Exonic
969772649 4:9331148-9331170 CAACTCGGGGGCCTGGAGGCAGG - Exonic
969773266 4:9335895-9335917 CAACTCGGGGGCCTGGAGGCAGG - Exonic
969773881 4:9340640-9340662 CAACTCGGGGGCCTGGAGGCAGG - Exonic
969774496 4:9345385-9345407 CAACTCGGGGGCCTGGAGGCAGG - Exonic
969775111 4:9350130-9350152 CAACTCGGGGGCCTGGAGGCAGG - Exonic
969775726 4:9354875-9354897 CAACTCGGGGGCCTGGAGGCAGG - Exonic
969776337 4:9359620-9359642 CAACTCGGGGGCCTGGAGGCAGG - Intronic
969776955 4:9364366-9364388 CAACTCGGGGGCCTGGAGGCAGG - Exonic
975461243 4:74655872-74655894 CATCTTGGTGTCCTGAAGGGAGG - Intergenic
978532448 4:109729310-109729332 CAACTTGGTGCAATTGAGGGGGG + Intronic
979913166 4:126396403-126396425 AAACCCAGTGCCCTGAAGGGAGG - Intergenic
981719963 4:147791602-147791624 CAACTCCATGCCCCGCAGGGAGG - Intronic
985539307 5:480490-480512 CCACCCTGTGCCCTGGAGGGCGG - Intronic
988623349 5:32845893-32845915 GAAGTCTGTGTCCTGGAGGGGGG + Intergenic
991107386 5:62860505-62860527 AAACTCACTGCCCTGAAGGGAGG - Intergenic
992758883 5:79934195-79934217 CAACCCGCTGCCATGGAGGCTGG + Intergenic
998148063 5:139741540-139741562 CACCTGGGTGCCAAGGAGGGCGG + Intergenic
999218244 5:149954140-149954162 CCACTCTCTGCCCTGGAGAGCGG - Intergenic
1001433403 5:171681234-171681256 CACCACAGTGTCCTGGAGGGAGG + Intergenic
1006519120 6:34561393-34561415 CAACATGGTGTCCTGGAGAGAGG - Intergenic
1007211749 6:40197916-40197938 CATCTCTCTGCCCTGGAGTGTGG - Intergenic
1007328201 6:41080035-41080057 CACACCAGTGCCCTGGAGGGTGG + Intronic
1007829132 6:44624921-44624943 CTACTGGATGCCCTGGAGGGTGG + Intergenic
1008916503 6:56793143-56793165 CATCTTGGAGTCCTGGAGGGTGG + Intronic
1010059453 6:71605876-71605898 CAAAGCAATGCCCTGGAGGGAGG - Intergenic
1012861586 6:104566695-104566717 CAAATCGGTGCCCATGAGAGTGG - Intergenic
1015305394 6:131701158-131701180 CAACACGGTGCCCCGGATGCTGG - Exonic
1018863525 6:167730633-167730655 CAAGGCTGTGCCCTGGATGGTGG + Intergenic
1018906991 6:168081230-168081252 CCCCTCAGTGCCCTGGCGGGAGG - Intronic
1019198638 6:170296609-170296631 CACCTCGGAGCCCTGGGGGCCGG + Intronic
1019611130 7:1937214-1937236 ACACTCAGTGCCCGGGAGGGAGG + Intronic
1024464818 7:49700933-49700955 CAACACGGGTCCCTGGGGGGCGG + Intergenic
1026019948 7:66698679-66698701 CACCTTGGAGCCCTGGAGGAGGG - Intronic
1026880410 7:73903889-73903911 CATCTTGGAGCCCTGGAGGAGGG + Intergenic
1029668638 7:102012679-102012701 CCACTCTGTGTCCTGGAGAGTGG + Intronic
1031122239 7:117735012-117735034 CAAGTCGGAGCCCTGGAGACAGG + Exonic
1031490920 7:122387033-122387055 AAACTCTGTGCCCTGGATGGAGG - Exonic
1032018805 7:128395317-128395339 CAACTCCGGGGCCTGGAGCGGGG + Intronic
1033739504 7:144259385-144259407 CAACACGGTGCCCCGGATGCTGG - Exonic
1034982533 7:155488171-155488193 CAACGCGGTGGGCTGGAGAGAGG - Intronic
1035158641 7:156934798-156934820 TACCTCAGTGCCCAGGAGGGTGG - Intergenic
1036273888 8:7333624-7333646 CAACTCGGGTGCCTGGAGGCAGG - Intergenic
1036294816 8:7527259-7527281 CATCTCTGTGCCCTGCTGGGAGG - Intergenic
1036296454 8:7541842-7541864 CATCTCCGTGCCCTGCTGGGAGG - Exonic
1036326112 8:7779177-7779199 CATCTCCGTGCCCTGCTGGGAGG + Exonic
1036327747 8:7793732-7793754 CATCTCTGTGCCCTGCTGGGAGG + Intergenic
1036347458 8:7976726-7976748 CAACTCGGGTGCCTGGAGGCAGG + Intergenic
1036842764 8:12137501-12137523 CAACTCGGGTGCCTGGAGGCAGG + Exonic
1036864040 8:12379005-12379027 CAACTCGGGTACCTGGAGGCAGG + Intergenic
1037767849 8:21782847-21782869 GAGCTCGGGGCCCTGCAGGGAGG + Exonic
1037776866 8:21841260-21841282 AAACTCAGTGCCCAGGAAGGAGG + Intergenic
1040581161 8:48699668-48699690 CACCTGGGGGCCCTGGAGGGGGG + Intergenic
1047295447 8:123566800-123566822 CAACTCAGCCTCCTGGAGGGTGG + Intergenic
1049277663 8:141727995-141728017 CAAATCGGTGCCCTGCTGGTGGG + Intergenic
1049386831 8:142347100-142347122 CAGCTCTGGGCCCTGGTGGGGGG + Intronic
1049591738 8:143465885-143465907 CGTCTCTGGGCCCTGGAGGGTGG - Intronic
1056481876 9:87013879-87013901 CAACGCAGGACCCTGGAGGGAGG - Intergenic
1057427964 9:94969223-94969245 CAGCTCACTGCCCTGGAAGGAGG + Intronic
1057784749 9:98078341-98078363 CATCTCGGTGAGCAGGAGGGAGG + Exonic
1060976947 9:127770513-127770535 CAACCCTGTGCCCTGGAGTCAGG - Intronic
1061159985 9:128888186-128888208 GAACTCTGTCCCCTGGAGAGAGG + Intronic
1062022511 9:134326208-134326230 CAACTCGGCGGCCGGGCGGGCGG + Intronic
1062354779 9:136156847-136156869 CCACTCGGGGCCCCGGGGGGAGG - Intergenic
1062464317 9:136674444-136674466 CAGCTTGGGGGCCTGGAGGGCGG - Intronic
1186422256 X:9435675-9435697 GAACTCAGTGTCCTGGAGGAAGG + Intergenic
1191100268 X:56719227-56719249 AAACTCAGTGCTGTGGAGGGTGG + Intergenic
1191700730 X:64038935-64038957 GAACTTGGTGCTCTGAAGGGAGG + Intergenic
1196942330 X:120789319-120789341 CAACTGTGTGCCCTGGTTGGGGG + Intergenic
1198537645 X:137601901-137601923 GAACTCATTGCCCTGAAGGGAGG + Intergenic
1199721842 X:150547818-150547840 CCACTCGGTGCCCTTGACCGCGG + Intergenic