ID: 1122536412

View in Genome Browser
Species Human (GRCh38)
Location 14:102466691-102466713
Sequence ACTGAGCTGCACACTGTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 312}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122536412_1122536414 24 Left 1122536412 14:102466691-102466713 CCTTCTACAGTGTGCAGCTCAGT 0: 1
1: 0
2: 4
3: 31
4: 312
Right 1122536414 14:102466738-102466760 TTAGCACCATCCAATTCCAGAGG 0: 1
1: 0
2: 2
3: 7
4: 102
1122536412_1122536415 25 Left 1122536412 14:102466691-102466713 CCTTCTACAGTGTGCAGCTCAGT 0: 1
1: 0
2: 4
3: 31
4: 312
Right 1122536415 14:102466739-102466761 TAGCACCATCCAATTCCAGAGGG 0: 1
1: 0
2: 1
3: 17
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122536412 Original CRISPR ACTGAGCTGCACACTGTAGA AGG (reversed) Intronic
900560997 1:3306235-3306257 ACTGAACTGCCCACTGCAGATGG - Intronic
901472316 1:9466172-9466194 ACTGAGTTGGTCACTGTAGAGGG - Intergenic
901519214 1:9769728-9769750 AATGAGCTGTACACTTTAAAAGG + Intronic
901936417 1:12630162-12630184 ACTGAGCTGAGACCTGTAGAAGG - Intergenic
903894510 1:26595078-26595100 ACTAAGCTGCACTTTGGAGATGG - Intergenic
904386372 1:30145050-30145072 TGTGATCTTCACACTGTAGAAGG - Intergenic
906268477 1:44454708-44454730 ACAGAACTGTACACTGTAAAGGG - Intronic
909425411 1:75518962-75518984 ACTGAACTGCATACTTTAAATGG + Intronic
910952748 1:92668329-92668351 ACTATGCTGCACACAGTAGGAGG - Intronic
912426681 1:109599265-109599287 ACTGAACTGTACACTTAAGATGG - Exonic
913305256 1:117423793-117423815 ACTGAACTGCACACTTAAAATGG - Intronic
913434268 1:118830926-118830948 TTTGAGATGCACACTGAAGAAGG + Intergenic
914995326 1:152538341-152538363 ACTGAGGTGGACCCTTTAGAAGG - Intronic
915735738 1:158083803-158083825 TCAGAGCTGCACACTACAGATGG - Intronic
916003051 1:160634808-160634830 ACTGGGCTGCACAGTGGAGAAGG - Exonic
917705362 1:177627805-177627827 ACTGGACTGCACACTTTAAAAGG + Intergenic
918933898 1:190894973-190894995 ACTGAGCTGTACACTTAAAATGG - Intergenic
919622137 1:199874756-199874778 ACTGAACTGGACACTGTAAGTGG + Intergenic
920939010 1:210463199-210463221 ACTGAACTGTACACTTTAAATGG - Intronic
921454247 1:215348616-215348638 ACTGAGCTTCATCCTGCAGAGGG + Intergenic
922132186 1:222790782-222790804 ACTGAACTGCACACTAAAAATGG + Intergenic
1063383085 10:5598764-5598786 ACAGAGCTGAACTCTGGAGAGGG + Intergenic
1063657690 10:8008638-8008660 CCTGTGCTCCACACTGGAGATGG - Intronic
1063684310 10:8221810-8221832 TATGAGCTACACACTGTACAAGG - Intergenic
1065542381 10:26783405-26783427 ACTGAACTGCACACTTAAAATGG + Intronic
1065808631 10:29420168-29420190 ACTGAGCAGCAGACTGAATACGG - Intergenic
1067578459 10:47423165-47423187 ACTGAGCTGACCACAGCAGAGGG + Intergenic
1068667480 10:59692516-59692538 ACTGAGCTGCACATATTAAATGG + Intronic
1069060457 10:63889193-63889215 ACTGTGCTGTGCACTGTAGGAGG - Intergenic
1069711453 10:70491618-70491640 ACTGAACTGTACACTTTAAAAGG - Intronic
1069851918 10:71411836-71411858 ACTGAACTGCACACTGAAAAAGG - Intronic
1070636627 10:78133983-78134005 TCTGAGCTGCCCACTGTATGTGG - Intergenic
1071903236 10:90143167-90143189 ACTGGGCTGTACACTTTAAATGG + Intergenic
1073313562 10:102561975-102561997 ACTGTGCAACACACTGTATAAGG - Intronic
1073521795 10:104137886-104137908 ACTGACTTGCACACTTTAAATGG + Intronic
1074769821 10:116725940-116725962 ACTGAGTTGCATTCTGTAAACGG - Intronic
1074844073 10:117381228-117381250 ACTGAACTGTACACTTTAAATGG - Intergenic
1075134440 10:119770974-119770996 ACTTAACTGCACACTTTAAAAGG - Intronic
1075160762 10:120022817-120022839 ACTGTGCTCCACACAGGAGAAGG - Intergenic
1076743872 10:132502994-132503016 GCTGAACTGCACACTTCAGAGGG + Intergenic
1077699474 11:4427627-4427649 ACTGAACTGCACACTTTAAATGG + Intergenic
1078236829 11:9492570-9492592 ACTCAGCTGTACACTCTAAATGG - Intronic
1078410484 11:11112153-11112175 ATTGAGTTGTACACTGTAAATGG + Intergenic
1079236759 11:18696587-18696609 ACTGAGTGGAACCCTGTAGATGG + Intronic
1079513670 11:21240838-21240860 ACTGGGCTGCAAACTTTAAAAGG - Intronic
1080509226 11:32950589-32950611 ACTGAACTGTACACTTTAAATGG - Intronic
1080520241 11:33062170-33062192 ACTGAGTTGTACACTTTAAAAGG - Intronic
1081024903 11:37998994-37999016 ACTGAGTTGTACACTTTAAAAGG + Intergenic
1081150129 11:39617989-39618011 ACTGAGTTGCACACTTGAAATGG + Intergenic
1083211099 11:61186911-61186933 ACTGAACTGTACACTTCAGATGG + Intergenic
1084220705 11:67675801-67675823 ACTGAATTGTACACTGTAAATGG + Intronic
1084728687 11:71059446-71059468 ATGGAGCTGTACACTTTAGATGG + Intronic
1085655300 11:78309262-78309284 ACTGAATTGTACACTGTAAAGGG - Intronic
1086923428 11:92613776-92613798 ACTGAACTGTACACTTTAAAAGG - Intronic
1087204708 11:95381836-95381858 ACTGTGCTACACACTGGAGATGG + Intergenic
1087777925 11:102273802-102273824 AAATAGCTGCACACTGGAGAAGG - Intergenic
1088412174 11:109546524-109546546 ACTGAACTGTACACTTTAAAGGG + Intergenic
1089153493 11:116383518-116383540 ACTGAACTGCACACTCTAAAAGG + Intergenic
1089515552 11:119029592-119029614 ACTGAGCGCCAAACTGTAGGGGG + Intronic
1089590207 11:119535264-119535286 ACAGAGCTGCATTCTGGAGAGGG - Intergenic
1089632034 11:119789847-119789869 ACTGAGCTGGAGACTGTGGTGGG - Intergenic
1089823279 11:121247412-121247434 ACTGACCTGAACTCAGTAGATGG - Intergenic
1090288924 11:125524893-125524915 ACTGAATTGTATACTGTAGATGG + Intergenic
1090574493 11:128086343-128086365 ACTGAGCTGGAAGCTCTAGAAGG + Intergenic
1091250854 11:134142651-134142673 CCTGAACTGCACACTTTAAAAGG - Intronic
1091492863 12:948386-948408 ACTGAATTGCACACTTTAAAAGG + Intronic
1091806641 12:3361652-3361674 CCTGAGCTGAACTCAGTAGAGGG - Intergenic
1092832050 12:12453709-12453731 ACTGAAATGCACACTGTAAAAGG - Intronic
1093027317 12:14256884-14256906 ACTTAATTGCACACTTTAGAAGG - Intergenic
1094445382 12:30524112-30524134 ACTGAGCATCACTCTGTAAAAGG - Intergenic
1096228267 12:49882995-49883017 ACAGAGCTGCACACACTTGAAGG + Intronic
1097833092 12:64246233-64246255 ACTGAACTGCACACTTTAAAAGG - Intergenic
1098502861 12:71214113-71214135 ACTGAGTTGAACACTCTAAATGG + Intronic
1098841241 12:75480689-75480711 AGTGAGCTGCACACCATATATGG + Exonic
1099201573 12:79684104-79684126 ACTGAACTGTACACTTTAAAAGG + Intronic
1099306132 12:80958623-80958645 ACTCAGTTGCACACTTTAAATGG - Intronic
1100096788 12:91049142-91049164 ACTTAGCAGCACAAGGTAGAAGG - Intergenic
1100401455 12:94233499-94233521 TCTGAGCTGCAGACTCTAAAAGG - Intronic
1102136077 12:110576808-110576830 ACTGAACTGTACACTTTAAAAGG + Intronic
1102442342 12:112972968-112972990 ACTGAATTGTACACTTTAGAAGG - Exonic
1103437101 12:120935393-120935415 ACTGAATTGCACACTTTAAAAGG - Intergenic
1103724206 12:122989786-122989808 CCTGAGCTGGACATTGGAGAAGG - Exonic
1104033179 12:125079736-125079758 ACTGAGCTGCAGGCTTTAAAAGG - Intronic
1104196720 12:126546946-126546968 ACTGAGTTGCACACTTGAAATGG + Intergenic
1105267332 13:18832991-18833013 ACTGAGTTGCACATTTTAAATGG + Intergenic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1108203480 13:48064579-48064601 ACTGAATTGCACACTTTAAAAGG - Intronic
1109602868 13:64656169-64656191 ACAGTGCTGTCCACTGTAGAAGG + Intergenic
1109717683 13:66237602-66237624 TCTGTGCTGCACATTGAAGAGGG - Intergenic
1111046851 13:82824876-82824898 TCTGAGGTGCACACAGTGGATGG - Intergenic
1111402961 13:87765089-87765111 ACTGAGCTATACACTGAAAAAGG - Intergenic
1111959517 13:94794569-94794591 ACTGAACTGTACACTTAAGATGG + Intergenic
1114702272 14:24691015-24691037 ACTGATTTGCACACTTTAAACGG - Intergenic
1119091839 14:71790061-71790083 ACTGAATTGCACACTTTAAAAGG - Intergenic
1119239599 14:73048184-73048206 AATGAGGCCCACACTGTAGATGG + Intergenic
1119367635 14:74107903-74107925 ACTGAATTGCACACTATAAATGG - Intronic
1119452071 14:74720225-74720247 ACTGAACTGTACACTTTAAAGGG - Intronic
1121298201 14:92847352-92847374 TCTGAGCTGCAGACTGCAGGAGG + Intergenic
1122536412 14:102466691-102466713 ACTGAGCTGCACACTGTAGAAGG - Intronic
1122743943 14:103887222-103887244 TCTGGGCTGGACACTGTGGAGGG + Intergenic
1123706130 15:22952342-22952364 ACTGAGCTGTACACTTAAAATGG + Intronic
1125623950 15:41090742-41090764 ACTGAATTGCACACTATATAAGG + Intronic
1126746973 15:51836170-51836192 ACTGAACTGTACACTTTAAATGG - Intronic
1128159182 15:65411952-65411974 ACTGAGTTGAACACTGTAAAGGG + Intronic
1128383076 15:67127462-67127484 TCTGAGCCGCACCCTGCAGACGG + Intronic
1129078089 15:73014774-73014796 ACTGAGCTGTACAGTGATGAAGG + Intergenic
1129620727 15:77142941-77142963 ACTGAATTGCACACTTTAGTAGG + Intronic
1130068348 15:80625470-80625492 ACTGAGCTGTATACTTTAAAAGG + Intergenic
1131769928 15:95726429-95726451 ATTGAGCTGCTCACTGTTGTAGG - Intergenic
1132357542 15:101183748-101183770 ACTGAGCTGGACTCTGGAGATGG - Intronic
1137590438 16:49690084-49690106 ACTGGGCTGCACTTAGTAGATGG - Intronic
1137656688 16:50165463-50165485 ACTGAACTGTACACTTTAAAAGG - Intronic
1138295919 16:55885087-55885109 GCTAAGCTGCACACTGCAGAAGG - Intronic
1138628112 16:58268922-58268944 ACTGAACTGTACACTTTAAATGG - Intronic
1138716278 16:59026665-59026687 ACTGAGCTGTACACTTAAAATGG + Intergenic
1139356341 16:66369048-66369070 ACTGAGGTGCAGGCTGCAGAGGG - Intronic
1139483489 16:67243866-67243888 GCTGAGCTGCAGACTGGTGAGGG - Intronic
1139737773 16:69006813-69006835 ATTGAGGTGTACACTGTAAATGG - Intronic
1139963701 16:70733016-70733038 ACTGAATTGCACACTTTAAAAGG - Intronic
1140416432 16:74776937-74776959 ACTGAACTGTACACTGAAAATGG + Intergenic
1140616073 16:76665841-76665863 ACTGAGCTGCAGACTGCAGAAGG - Intergenic
1141924863 16:87161415-87161437 ACTGAGTTGTACACTTTAAATGG + Intronic
1142293436 16:89203147-89203169 ACTGAACTGCACACTTAAAATGG - Intergenic
1143456381 17:7070707-7070729 CCTGGGCTTCACACTTTAGAGGG + Intergenic
1143690269 17:8556726-8556748 ACTGAACTGTACACTGAAAAAGG + Intronic
1143809082 17:9455948-9455970 GATGAGCTGTACACTGCAGATGG - Intronic
1143956303 17:10672519-10672541 ACTGAACTGCGCACTTTAAAAGG - Exonic
1144050988 17:11497043-11497065 ACTGAGCTACACACTGTAGTGGG + Intronic
1144435921 17:15240643-15240665 CCTGAGTTCCACACTGTAGAGGG + Intronic
1145108600 17:20141585-20141607 ACTGGATTGCACACTGTAAATGG - Intronic
1145897531 17:28469053-28469075 ACTGAGCTGTACACTGAAAAAGG + Intronic
1146600152 17:34207068-34207090 ACTGAACTGTACACTTTAAAGGG - Intergenic
1147368716 17:39976647-39976669 AATGTGCTGCCCACTGTATAGGG + Intronic
1148061307 17:44838413-44838435 GCTGAGCTGCATACTTTTGATGG + Intergenic
1148544430 17:48506529-48506551 ACTGAGGTCCCCGCTGTAGATGG + Intergenic
1149041109 17:52189360-52189382 ACTGAGTTGCACACTTTGAAAGG - Intergenic
1150596600 17:66611218-66611240 ACTGAGCTATACACTTTAAATGG - Intronic
1153070150 18:1096161-1096183 ACTGAACTGTACACTGAAAATGG - Intergenic
1154091598 18:11369082-11369104 ACTCAACTGTACACTGTAGGAGG - Intergenic
1154421081 18:14228439-14228461 ACTGAGTTGCACATTTTAAATGG - Intergenic
1156371147 18:36472435-36472457 ACTGAATTGCACACTTTAAAAGG - Intronic
1157744540 18:50123382-50123404 ACTGAACTGTACACTTTAAATGG + Intronic
1158296327 18:56000962-56000984 CCTGAACTGTACACTGTAAAAGG + Intergenic
1159063129 18:63538224-63538246 ACTGAGTTACACACTTTAAAAGG - Intergenic
1160333479 18:78016464-78016486 ACTGACATGTACACTTTAGAAGG + Intergenic
1161174072 19:2829729-2829751 ACTGAACTGCACACTTAAAAGGG - Intronic
1162061741 19:8100305-8100327 ACTGAACTGCACACTAAAAATGG + Intronic
1162574872 19:11493467-11493489 AGTGAGATGCCCACTGTTGATGG + Intronic
1163052674 19:14696227-14696249 ACTGAACTGCACACTTTAAAGGG - Intronic
1163227565 19:15975271-15975293 GCTGAGCTGCCCAGTGTTGAAGG - Intergenic
1163327342 19:16613572-16613594 ACACTGCTGCCCACTGTAGAGGG - Intronic
1163639584 19:18454132-18454154 ACTGAGCTGCTCACTTTAAATGG + Intronic
1164865066 19:31597908-31597930 ACAGAGCTGCAGACTCCAGAAGG - Intergenic
1166695632 19:44849914-44849936 ACTGAACTGTACACTTTAAATGG + Intronic
1167354822 19:48997025-48997047 ACTGAGCTGTATACTTTAAATGG - Intronic
1168548482 19:57273701-57273723 ACTGAACTACACACTGTATTTGG + Intergenic
925472601 2:4179030-4179052 ACTGAACTGCACACTTAAGATGG + Intergenic
925525215 2:4792881-4792903 AATGAGCTGCACAAGGTAGAGGG - Intergenic
925600492 2:5604095-5604117 ACTGAGATGCTCAATCTAGAAGG - Intergenic
926130410 2:10300232-10300254 ACTGAGCTGTTCACTTTAAAAGG + Intergenic
927859031 2:26548355-26548377 ACTGAACTGTGCACTTTAGAAGG - Intronic
928064078 2:28145604-28145626 ACTGAACTGTACACTTTAAATGG - Intronic
928878683 2:36071894-36071916 CCTGTGCTGGACACTGTAGGTGG + Intergenic
929191412 2:39143900-39143922 ACTGAATTGCACACTTAAGATGG - Intergenic
929484349 2:42340856-42340878 ACTGCGCAGCACACTGCAGAAGG + Intronic
929679993 2:43983992-43984014 AATGATCAGCACATTGTAGATGG + Intronic
930013759 2:46957034-46957056 AACGAGCTGCACACAGTGGAGGG - Intronic
930828253 2:55716046-55716068 ACTGTACTGTAAACTGTAGATGG + Intergenic
931310422 2:61074364-61074386 ACTGAACTACACACTTTAAAAGG - Intronic
931959165 2:67462729-67462751 ACTGAGCTGATGACTGTAGCAGG - Intergenic
932141163 2:69279584-69279606 ACTGAGTTGTACCCTTTAGATGG - Intergenic
933565136 2:83940975-83940997 GCTGAGCAGAACACTATAGATGG + Intergenic
933914009 2:86970350-86970372 ACTGAACTGTACACTTTAAATGG - Intronic
934008984 2:87799548-87799570 ACTGAACTGTACACTTTAAATGG + Intronic
934197234 2:89848842-89848864 AATGTGCAGGACACTGTAGAAGG - Intergenic
935772573 2:106440239-106440261 ACTGAACTGTACACTTTAAATGG + Intronic
935907499 2:107855675-107855697 ACTGAACTGTACACTTTAAATGG - Intronic
936129289 2:109820817-109820839 ACTGAACTGTACACTTTAAATGG - Intronic
936215408 2:110550668-110550690 ACTGAACTGTACACTTTAAATGG + Intronic
936424545 2:112405241-112405263 ACTGAACTGTACACTTTAAATGG + Intronic
936931510 2:117794440-117794462 ATTGAGGTGCACATTGTTGATGG + Intergenic
937545590 2:123014755-123014777 ACTGAACTGTACACTGAAAATGG + Intergenic
937882849 2:126881481-126881503 ACTGAGCTGTACATTTTAAAAGG + Intergenic
938370483 2:130764943-130764965 AAAGAGCTGCACATTGTAAATGG + Exonic
938898363 2:135775744-135775766 ACTGAACTGTACACTTTAAAAGG + Intronic
939518819 2:143203732-143203754 ACTGAGCTCCAAAATGAAGAGGG - Intronic
942860427 2:180603432-180603454 ACTAAGATGATCACTGTAGAGGG + Intergenic
943944694 2:194044477-194044499 ACTAGGCTGCACACAGTAGAGGG - Intergenic
945143763 2:206715095-206715117 GCTGAGCTGCTCACTGTGGCTGG + Intronic
946626755 2:221620390-221620412 ACTGAACTGTACAGTGAAGATGG - Intergenic
947596439 2:231414909-231414931 ACTGTGCTGCACACTAGAGAAGG - Intergenic
947746060 2:232507897-232507919 ACGGAGCTGCCCGCTGCAGACGG + Intergenic
948014509 2:234677084-234677106 ACTCAGATGCAGACTGCAGATGG - Intergenic
1170033558 20:11967257-11967279 ATTGTCCTGGACACTGTAGATGG + Intergenic
1170992252 20:21313955-21313977 ACTGAGTTGTACACTTTAAATGG - Intronic
1171424672 20:25042136-25042158 ACTGTGCTGCAGTCTGAAGATGG + Intronic
1172137053 20:32693838-32693860 ACTGAACTGCATACTCAAGAAGG + Intergenic
1172440409 20:34961520-34961542 ACTGAATTGCACACTTTAAAGGG - Intergenic
1176077710 20:63255822-63255844 ACTGAGCACTACACTGTAAAGGG + Intronic
1177346250 21:19875236-19875258 ACTGAATTGCACACTTTAAAAGG + Intergenic
1177738547 21:25123760-25123782 ACTGAATTGAACACTGTAAAAGG + Intergenic
1178307958 21:31506367-31506389 ACTGAACTGTACACTTAAGAAGG - Intronic
1179676097 21:42983167-42983189 ACTGAACTGCACACTGAAAATGG - Intronic
1179804277 21:43827037-43827059 CCTGAGCTGCCCTCTGGAGAAGG + Intergenic
1180924859 22:19546514-19546536 ACTGAACTGCATACTGAAAATGG + Intergenic
1180924944 22:19547176-19547198 ACTGAACTGCATACTGAAAATGG - Intergenic
1182387891 22:29962285-29962307 ACTGAACTGTACACTTTAAATGG - Intronic
1182873888 22:33673562-33673584 ACTGAGCTGTACACTTCAAATGG - Intronic
949756651 3:7419170-7419192 ACTGGGGTGCACACTATATAGGG + Intronic
949921404 3:9005893-9005915 ACTCAGCTGAACACTTTAAAAGG + Intronic
950135465 3:10577653-10577675 CCTGGGCTGCACAATGTAGATGG + Intronic
950252264 3:11475594-11475616 GCTGATCTGCAGACTGCAGAGGG - Intronic
950322106 3:12066087-12066109 ACTGAATTGCACACTTTAAAAGG + Intronic
953062223 3:39436588-39436610 ACTGAGTTGTACACTTTAAATGG - Intergenic
953633014 3:44635942-44635964 ACTGAACTGTACACTTTAAATGG - Intronic
954046962 3:47940177-47940199 GCTGTGCTGCACCCTGTGGAAGG - Intronic
954570718 3:51638542-51638564 GCTGAGTTGCACACTGCAGGGGG - Intronic
954859809 3:53677950-53677972 AGTGAGCTGAAGAATGTAGAGGG + Intronic
955152679 3:56383716-56383738 ACTGAACTGTACACTTGAGATGG - Intronic
955931988 3:64066592-64066614 ACTGAACTGCAGAATGGAGAAGG + Intergenic
956182758 3:66532853-66532875 ACTGAGCTGTACACTTTAAAAGG + Intergenic
957278326 3:78117217-78117239 ACTGTGCTGTGCACTGTAAAAGG - Intergenic
957283662 3:78187040-78187062 GCTTAGGTGTACACTGTAGAAGG - Intergenic
957987509 3:87590377-87590399 ACTAGGCTGCACACAGCAGAGGG + Intergenic
960005293 3:112775426-112775448 TCTGACCTCCACACTCTAGAAGG + Intronic
960119021 3:113927650-113927672 ACTGGGCTGGACACTCTAGCAGG + Intronic
961429165 3:126868169-126868191 CCTGAGCTGGACTCTGTAGGGGG - Intronic
961481846 3:127185770-127185792 ACTGAATTGCACACTTTAAAAGG - Intergenic
961550892 3:127670111-127670133 ACTGAGCACCACACTGTGCAAGG + Intronic
962519214 3:136182761-136182783 ACTGAGCTGAAGACTTGAGAGGG - Intronic
967112336 3:186304945-186304967 ACTGTACTGGGCACTGTAGAAGG - Intronic
967344722 3:188441985-188442007 ACTCAGCTGTACACTCTACAGGG + Intronic
968268836 3:197384043-197384065 AATGAGCTGCAGATAGTAGATGG - Intergenic
969061619 4:4439819-4439841 ATTGAGCTGAGCCCTGTAGATGG - Intronic
969512745 4:7628826-7628848 ACTGAACTGTACACTCGAGAAGG + Intronic
969849276 4:9943616-9943638 ACTGAGCTGTATACTTTAAAAGG + Intronic
970320015 4:14866117-14866139 ACTGAACTGTACACTTTAAAGGG + Intergenic
970483244 4:16498938-16498960 ACTAGGCTGGACATTGTAGATGG - Intergenic
971805062 4:31347014-31347036 ACTGAACTGTACACTTTAAAAGG + Intergenic
972309857 4:37870259-37870281 ACAGAGCTGCACACACTAAATGG - Intergenic
972656021 4:41064360-41064382 ACTGAGCTGCACAAGGTAATAGG + Intronic
975204082 4:71624240-71624262 CCTGGGCTGCACACAGTAGGGGG + Intergenic
976308548 4:83586278-83586300 AATGAGCTTCACCCTGGAGAGGG + Intronic
983580661 4:169306529-169306551 ACTGAACTGTACACTTTAGAAGG + Intergenic
984754802 4:183315042-183315064 ACAGAACTTCACACTGTACATGG - Intronic
988850552 5:35176365-35176387 ACAGAACTGTACACTGTAAAAGG - Intronic
989051421 5:37323885-37323907 ACTAAACTGCACACTTTAAAAGG + Intronic
990514447 5:56518748-56518770 TCTGTGCTCCACACTGTGGAGGG + Intronic
992794486 5:80243488-80243510 ACACAGATGCACACTGAAGAGGG + Intronic
995896539 5:117018947-117018969 ACGGAGGTGCCCACTGTAGAAGG + Intergenic
996542215 5:124642391-124642413 AATGAGCCTCACACTGTACAAGG + Intronic
996571985 5:124941574-124941596 ATTGAGTTGCACACTTTAAATGG + Intergenic
996754521 5:126921841-126921863 ACTCAGCTGCACACAGTGGGAGG + Intronic
997672553 5:135687932-135687954 ACTGAGCTGTACACTTAAAATGG - Intergenic
998189763 5:140013489-140013511 ACTGAACTGCACACTTAAAATGG + Intronic
999630445 5:153565474-153565496 ACTGAACTGAACACTTTAAATGG - Intronic
999955512 5:156697205-156697227 ACTGAATTGCACACTTTACATGG + Intronic
1000206638 5:159066653-159066675 ACTCAGCTTCACACTTTAGCAGG + Intronic
1000444201 5:161299929-161299951 ACTGTTCTGCATACTGAAGATGG - Intronic
1000576951 5:162986754-162986776 TATGAGATGGACACTGTAGATGG - Intergenic
1002846667 6:952289-952311 ACTGAGCAGCTCACTGAATAGGG - Intergenic
1003142977 6:3486946-3486968 AATGAGCTGCACACTTCAAACGG + Intergenic
1003321120 6:5052695-5052717 ACTGAACTGTACACTGAAAATGG + Intergenic
1003562293 6:7191270-7191292 ACTGAAGTGCACACTTTACACGG - Intronic
1003593041 6:7451777-7451799 ACTGAACTGTACACTTTAAAAGG + Intergenic
1004445189 6:15691532-15691554 GCTGAGCTCCTCACTGGAGAGGG + Intergenic
1004455381 6:15787048-15787070 ACTCAGCTGCACATTGAAGTTGG + Intergenic
1004737114 6:18418685-18418707 ACTGAATTGTACACTTTAGATGG + Intronic
1004858888 6:19780923-19780945 ACAGTGCTGTACACTGTAGGTGG + Intergenic
1006058326 6:31402034-31402056 ACTGAGCTGCACACTTTAAAAGG - Intronic
1009433868 6:63595855-63595877 ATTGAGTTGTACACTGTAAATGG + Intergenic
1010759462 6:79706430-79706452 ACTGTTCTGCAGATTGTAGATGG - Intergenic
1010835801 6:80586459-80586481 CCTAAGCTGCACACAGTAGGGGG - Intergenic
1010991521 6:82485062-82485084 ACTGAGCTGTACCCTTTAGCTGG - Intergenic
1011613805 6:89179790-89179812 ATTGAGCTGCACACTGGAGGAGG + Intronic
1013151351 6:107449327-107449349 ACTGAGCTGTACACTTAAAATGG - Intronic
1013526704 6:110981220-110981242 ACTGAATTGTACACTGTAAAGGG + Intergenic
1015169757 6:130239583-130239605 ACAGATTTGAACACTGTAGAGGG + Intronic
1015826981 6:137324276-137324298 ACTGGACTGCCCACTGCAGATGG + Intergenic
1016693930 6:146970636-146970658 ACTTAGTTCCACAGTGTAGAGGG - Intergenic
1016746235 6:147582903-147582925 TCTGAGCTGTACACTGTGGTAGG - Intronic
1017149476 6:151265276-151265298 ACTGACCTGTACACTTTAAAGGG - Intronic
1017722573 6:157254061-157254083 ACTGAATTGCACACTTTAAATGG - Intergenic
1018182316 6:161234823-161234845 ATTGAACTGGACACTGAAGAAGG - Intronic
1018729619 6:166638807-166638829 CCTGTCCTGTACACTGTAGAGGG - Intronic
1021387586 7:20050798-20050820 GCTGAGAGGCAGACTGTAGAAGG - Intergenic
1021770324 7:23994143-23994165 ACTGAACTGCACACTTAAAATGG + Intergenic
1022024770 7:26437279-26437301 AGTGTGCTGCAGACTGAAGAAGG + Intergenic
1022596670 7:31719478-31719500 ACTCAGCTGCTCAGTGTTGAAGG - Intergenic
1024026987 7:45419563-45419585 ACTTAGCTGCACACTCATGATGG - Intergenic
1027196613 7:76034932-76034954 ACTGAGCTGCAGACTCTAGAAGG + Intronic
1027491614 7:78834226-78834248 ACTGACCTGTACACTTTAAAAGG - Intronic
1027511724 7:79090919-79090941 GCTGAGCTGTACACTGTTGTGGG - Intronic
1029164625 7:98578629-98578651 ACTGACCTGTACACTTTAAACGG - Intergenic
1029237878 7:99137517-99137539 ACGAAGCTGCAGATTGTAGATGG - Intronic
1030082556 7:105790268-105790290 ACTGAACTGTACACTTTAAATGG + Intronic
1030981184 7:116186641-116186663 ACTGTGCTGCACCCTGGAGTGGG + Intergenic
1031542739 7:123014963-123014985 ACTGAACTGTACACTTTAAATGG - Intergenic
1032573498 7:133027300-133027322 ACTGAACTGCACACTCTGAATGG + Intronic
1033294996 7:140124339-140124361 ACTGAGCTGTACACTTTAAAAGG + Intronic
1033432542 7:141302098-141302120 ACTGAACTGTACACTGAAAATGG + Intronic
1034523131 7:151636199-151636221 ACTGGGCTGCACACTTTAAATGG - Intronic
1035197352 7:157232922-157232944 ACTGAACTGTACACTTTAAAAGG - Intronic
1036145774 8:6253329-6253351 GCTGTGCTGCACACTGTACTGGG + Intergenic
1036227101 8:6968897-6968919 AGAGAGCTGCACAGTCTAGAGGG - Intergenic
1039858896 8:41439457-41439479 ACTGAGGTGGACACGGTACAAGG - Intergenic
1043685279 8:83076950-83076972 ACTGAATTGTACACTGTAAAAGG + Intergenic
1043930607 8:86086630-86086652 ACTGAATTGCACACTTTAAATGG + Intronic
1046606080 8:116373612-116373634 CCTAAGCTGCACACAGCAGAGGG + Intergenic
1048007091 8:130428178-130428200 AGTGAGATGGACACTGAAGAGGG - Intronic
1049465691 8:142750353-142750375 ACTGAGCTGTGCAATGTAGACGG - Exonic
1049467691 8:142759848-142759870 ACTGAGTTACCCACTGTAAACGG - Intergenic
1049467718 8:142760044-142760066 ACTGAGTTACCCACTGTAAACGG - Intergenic
1049467725 8:142760093-142760115 ACTGAGTTACCCACTGTAAACGG - Intergenic
1049467745 8:142760240-142760262 ACTGAGTTACCCACTGTAAATGG - Intergenic
1049467752 8:142760289-142760311 ACTGAGTTACCCACTGTAAACGG - Intergenic
1049467759 8:142760338-142760360 ACTGAGTTACCCACTGTAAACGG - Intergenic
1049467766 8:142760387-142760409 ACTGAGTTACCCACTGTAAACGG - Intergenic
1049467891 8:142761318-142761340 ACTGAGTTACCCACTGTAAACGG - Intergenic
1050556500 9:6793905-6793927 ACTGAATTGCACACTTTAAATGG - Intronic
1050673110 9:8020132-8020154 ACTGAGCTGCACAGAGTGTATGG + Intergenic
1051806750 9:21002672-21002694 ACTGAACTGCACACTTAAAAAGG + Exonic
1051861271 9:21627599-21627621 ACTGAGCTGGAAGCTGTAGCAGG - Intergenic
1051924221 9:22304192-22304214 ACTGAGCTGCACACTTAAAATGG - Intergenic
1052168762 9:25367526-25367548 ACTGAACTGCATACTTTAAATGG - Intergenic
1053515985 9:38731247-38731269 TCAGAGCTGCCCACTGTGGATGG - Intergenic
1055658310 9:78474487-78474509 ACTGAGCCACTGACTGTAGAAGG - Intergenic
1057269119 9:93637340-93637362 ACCGAACTGCACACTTTAAATGG - Intronic
1057752283 9:97802773-97802795 ACTGAACTGCACACTTAAAATGG + Intergenic
1059462927 9:114446461-114446483 ACTGATTTGCACACTTTAAAAGG + Intronic
1059774715 9:117463570-117463592 ACTGGGCTGAACACTGTGCATGG + Intergenic
1186636482 X:11410595-11410617 ACTGAACTGTACACTTTAAATGG + Intronic
1186830325 X:13383782-13383804 ACTGTCCTGTGCACTGTAGAGGG - Intergenic
1187586197 X:20664529-20664551 ACTGAACTGTACACTTTAAAAGG + Intergenic
1187590820 X:20715184-20715206 AGTGAGCTGCACTCTGCTGATGG - Intergenic
1188281902 X:28280814-28280836 ACAAAGCTGTCCACTGTAGATGG - Intergenic
1189764510 X:44356626-44356648 ACTGAATTGTATACTGTAGAAGG + Intergenic
1190363641 X:49671717-49671739 ACTGAATTGCACACTTTAAAAGG - Intergenic
1191606934 X:63072305-63072327 CCTGGGCTGCACACTGCAGGAGG + Intergenic
1192484877 X:71516463-71516485 ACTGAACTGCACACTTAAAAAGG + Intronic
1193211171 X:78808937-78808959 ACTGTCCTGCACACTGCAAATGG + Intergenic
1195137295 X:101921781-101921803 ACTGAGCTGTACACTTAAAATGG - Intronic
1195413263 X:104592340-104592362 ACTGATAAGCACAATGTAGAAGG - Intronic
1195523661 X:105860437-105860459 ACTGAGCTGTATACTTTAAAAGG - Intronic
1196236723 X:113290062-113290084 ACTGAGCTTCAAACTGTATGGGG + Intergenic
1197629243 X:128838986-128839008 ACTGAACTGTACACTTTAAAAGG - Intergenic
1201368595 Y:13235443-13235465 CCTGAGCTGCACACTCCACAGGG - Intergenic
1202047608 Y:20750291-20750313 ACTGAAATGCACACTTTTGAAGG + Intergenic