ID: 1122539017

View in Genome Browser
Species Human (GRCh38)
Location 14:102486543-102486565
Sequence CTGTGGAAGGGGCAGTTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 256}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122539017_1122539026 1 Left 1122539017 14:102486543-102486565 CCATGAAACTGCCCCTTCCACAG 0: 1
1: 0
2: 3
3: 31
4: 256
Right 1122539026 14:102486567-102486589 GGCCCTGAGGCACCTCTGCAAGG 0: 1
1: 0
2: 2
3: 17
4: 305
1122539017_1122539032 16 Left 1122539017 14:102486543-102486565 CCATGAAACTGCCCCTTCCACAG 0: 1
1: 0
2: 3
3: 31
4: 256
Right 1122539032 14:102486582-102486604 CTGCAAGGCCAGGGCCCCACAGG 0: 1
1: 0
2: 2
3: 35
4: 365
1122539017_1122539034 25 Left 1122539017 14:102486543-102486565 CCATGAAACTGCCCCTTCCACAG 0: 1
1: 0
2: 3
3: 31
4: 256
Right 1122539034 14:102486591-102486613 CAGGGCCCCACAGGCGCTGCTGG 0: 1
1: 0
2: 1
3: 32
4: 296
1122539017_1122539029 6 Left 1122539017 14:102486543-102486565 CCATGAAACTGCCCCTTCCACAG 0: 1
1: 0
2: 3
3: 31
4: 256
Right 1122539029 14:102486572-102486594 TGAGGCACCTCTGCAAGGCCAGG 0: 1
1: 0
2: 0
3: 15
4: 244
1122539017_1122539030 7 Left 1122539017 14:102486543-102486565 CCATGAAACTGCCCCTTCCACAG 0: 1
1: 0
2: 3
3: 31
4: 256
Right 1122539030 14:102486573-102486595 GAGGCACCTCTGCAAGGCCAGGG 0: 1
1: 0
2: 2
3: 18
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122539017 Original CRISPR CTGTGGAAGGGGCAGTTTCA TGG (reversed) Intronic
901062297 1:6477337-6477359 CTCTGGAAGGGGCACGCTCATGG + Intronic
901808539 1:11752612-11752634 GTGTGGAAGGGGCAGCCACATGG - Intronic
902385155 1:16072222-16072244 CTGGGGAAGGGGAAGGTACAGGG - Intronic
903967996 1:27101827-27101849 CTGTGGGAGGGACAGCGTCAGGG + Intronic
904350475 1:29902094-29902116 CTGAGGGTGGGGCATTTTCAGGG + Intergenic
904886617 1:33743168-33743190 GTGTGGATGGGGCAGTTCCCAGG - Intronic
905173499 1:36122926-36122948 GTGTGGAGGGGGAAGCTTCAGGG - Intronic
905336245 1:37246655-37246677 GTGGGGAAGGGGCAGTTCCGAGG - Intergenic
906103083 1:43275485-43275507 CTTTGGGAGGGACAGATTCAGGG - Intergenic
906716019 1:47969888-47969910 CACTGGAAGGGGCAGCTTCGAGG - Intronic
908017346 1:59857208-59857230 CTGTGGATGGGGCTTTTTAAGGG + Intronic
909149787 1:71987417-71987439 CTGTGGAAGGGGTAGGTGAAGGG + Intronic
909323546 1:74320361-74320383 CTGTGGAAGCACCAATTTCATGG + Intronic
909922822 1:81402732-81402754 CTGTGGACAGTGCAGTTTCAAGG - Intronic
909981458 1:82106720-82106742 CTGGGGCAGGGGGAATTTCAAGG - Intergenic
910469694 1:87539063-87539085 TGATGGAAGGGGCAGTCTCAAGG - Intergenic
911513452 1:98837386-98837408 TTGTGGAAGGGGCAGTGGAAAGG + Intergenic
915474907 1:156147577-156147599 CTGGGGGAGGGGCAGCCTCAGGG + Intronic
916056010 1:161069408-161069430 CTGGGGAAGGGGCAGTGGCCTGG - Intronic
916501523 1:165391598-165391620 CTTTGGAAGGTGGATTTTCAAGG + Intergenic
916600721 1:166290736-166290758 GTCTGGCAGGGGCAGTCTCACGG + Intergenic
916951941 1:169789535-169789557 CTGAGAAATGGGCAGTTTAAAGG + Intronic
916998673 1:170330643-170330665 CTTTAGAAGGTGCAGTTTCATGG - Intergenic
920029675 1:203028980-203029002 CTGTGGAAGGGGCTGCTTCTAGG + Intronic
921108454 1:212008697-212008719 TTTTTGGAGGGGCAGTTTCAAGG - Intronic
921263015 1:213400526-213400548 CTCTGGAAGGGGCAGGGACAGGG - Intergenic
922181980 1:223242833-223242855 CTGTGGCAGGGCCAGAGTCATGG - Intronic
1063269168 10:4487493-4487515 GTGGGGAGAGGGCAGTTTCAAGG - Intergenic
1064337404 10:14456391-14456413 CTGTGGAAGGGGATGTTTATAGG - Intronic
1066251468 10:33637237-33637259 CTTCAGATGGGGCAGTTTCAGGG + Intergenic
1067031177 10:42879514-42879536 GTGTGGAGGGGGCAGGATCAGGG + Intergenic
1067086994 10:43247740-43247762 TTGGGGAAGGGGCAGTTTGAGGG + Intronic
1067455200 10:46414250-46414272 CCTTGGAAGGGGAAGCTTCATGG - Intergenic
1067632000 10:47970384-47970406 CCTTGGAAGGGGAAGCTTCATGG + Intergenic
1067720237 10:48722589-48722611 CAGTGGAATGGGAAGTTGCATGG + Intronic
1067757152 10:49013797-49013819 CAGTGCAAGGGGCAGTTTTAGGG + Intergenic
1068438367 10:57019568-57019590 TTGTGGAAGGGGCAGTGGGAGGG - Intergenic
1070791962 10:79195013-79195035 CTGTGAAAGGGGCAGCGTCTTGG + Intronic
1070991058 10:80732547-80732569 CTGTGGAAGTGCCTGTTTCCTGG - Intergenic
1072878644 10:99202971-99202993 CTGAGGAGGGCCCAGTTTCAGGG - Intronic
1073230058 10:101961587-101961609 CTGTGTCAGGAGCAGTTTCAAGG + Intronic
1073849440 10:107597630-107597652 CTGGGGAATGGGCAGTTTACGGG - Intergenic
1074103879 10:110374679-110374701 CAAGGGAAGGGGCACTTTCAAGG - Intergenic
1074587333 10:114780833-114780855 CAGTGGACAGGGCAGGTTCAAGG + Intergenic
1074826374 10:117217941-117217963 CTGGGGAAGGGACAGTGTCAGGG - Intergenic
1076522947 10:131092247-131092269 CTGTGTGAGTGGCATTTTCATGG + Intergenic
1078106755 11:8362748-8362770 CTGAGGAAGGGGCAGCTTCAGGG - Intergenic
1083656151 11:64230658-64230680 CAGAGGAAGGGGCAGGTCCAAGG + Exonic
1083670833 11:64299266-64299288 CTGGTGAAGGGGCAGGTTCCCGG + Intronic
1083795918 11:65016606-65016628 CTGGGGGAGGAGCAGGTTCAGGG + Intronic
1085022655 11:73218909-73218931 ATGTTGAGGGGGCAGTTGCAGGG + Intronic
1085449323 11:76622601-76622623 CAGTGGGAGGGGCCGTTGCAGGG - Intergenic
1086604136 11:88674648-88674670 CTCTGGAAGGAGCAGATTCCTGG - Intronic
1087019384 11:93587300-93587322 TTGATGAAGGGGCATTTTCATGG + Intergenic
1087640990 11:100753468-100753490 CTGTGGCTGGAGCAATTTCAAGG + Intronic
1088071636 11:105793595-105793617 CTGTGGGAGGAACAGCTTCATGG - Intronic
1091935049 12:4428306-4428328 CTCAGGAAGGGGCAGTGTGAAGG + Intronic
1094523776 12:31218734-31218756 GTGTGGAGGGGGCAGATGCAGGG + Intergenic
1096544030 12:52324657-52324679 CTGTGGAAGTGACATTTCCATGG + Intergenic
1097185127 12:57192659-57192681 CTGTGGGAGGGCCAGGTGCATGG - Intronic
1100212092 12:92408219-92408241 GGGTGGAAGGGGCAGTTAAAGGG - Intergenic
1102038563 12:109786264-109786286 CTGAGGAATGTGCAGTTTCCAGG - Intronic
1104065999 12:125306473-125306495 CTGTGGGAGGAACAGATTCAGGG - Intronic
1105887162 13:24652071-24652093 TGGCGGAAGGTGCAGTTTCAGGG - Intergenic
1109009304 13:56919919-56919941 TTGTAGGAGGGTCAGTTTCATGG + Intergenic
1114239553 14:20853825-20853847 GTGGGGTAGGGGCAGTTCCAGGG + Intergenic
1114701261 14:24680770-24680792 CTGCAGAAGGGCCAGTGTCAGGG + Intergenic
1117879037 14:60290299-60290321 ATGAGGAAGGGGAATTTTCAGGG - Intronic
1118082525 14:62377743-62377765 CTGGGGAAGGGACAGGTACAGGG - Intergenic
1118210932 14:63765075-63765097 CTGAGGAAGGGGCTGTTCTAAGG + Intergenic
1119729491 14:76941976-76941998 CTGTGGGCGGAGGAGTTTCAGGG + Intergenic
1121601980 14:95212196-95212218 CTGTGCAAGGTGCTCTTTCATGG + Intronic
1122539017 14:102486543-102486565 CTGTGGAAGGGGCAGTTTCATGG - Intronic
1202860549 14_GL000225v1_random:79015-79037 ATGTGGCAGGGGCAGATGCAAGG - Intergenic
1124128496 15:26962598-26962620 CTGTTGAAGGTGTATTTTCAGGG - Intergenic
1125332244 15:38593686-38593708 CTTAGGAAGGGGCAGTGGCAGGG - Intergenic
1125879873 15:43184970-43184992 CTGTCAAAGGTGCAATTTCAGGG + Exonic
1126111277 15:45176187-45176209 TTGTCGAAGGGAAAGTTTCAAGG - Intronic
1127930833 15:63596301-63596323 CTCAGGAAGGGGGAGCTTCACGG + Intergenic
1129383055 15:75179690-75179712 CTGTCATAGGGGTAGTTTCATGG + Intergenic
1130335446 15:82953325-82953347 CACTTGAAGGGGCAGTTTTAAGG + Intronic
1131724516 15:95207106-95207128 CTGTGGAAGGGACTGCTACAAGG - Intergenic
1131777999 15:95823189-95823211 CTGGGGAAGGGGAGGTGTCAAGG + Intergenic
1132691050 16:1182113-1182135 CTGTGGCAGGGGCAGGAGCAGGG + Intronic
1132896142 16:2230282-2230304 CTGTGGGAGGGGCTGTTGCGAGG + Intronic
1134261185 16:12652252-12652274 GTGTGGATGGAGCAGTTTCACGG - Intergenic
1134300324 16:12984976-12984998 CTGAGCAAGGGACAATTTCAGGG - Intronic
1134367447 16:13592423-13592445 CTGAAGTAGGGGCAGTTTCTGGG + Intergenic
1134376573 16:13681181-13681203 CTGTGGAAGGCTCAGGTTGATGG + Intergenic
1135502716 16:23011196-23011218 CAGTGGAAGGGGAACTCTCAAGG + Intergenic
1136060268 16:27721576-27721598 GGGTGGAAGGGGCAGGTCCACGG - Exonic
1138521577 16:57574414-57574436 GGGTGGAAGGGGAAGTTTCCAGG + Intronic
1140255695 16:73334289-73334311 CCGTGGGAGGGCCATTTTCACGG + Intergenic
1140579893 16:76217732-76217754 CTTTGGAAGGTCCAGTTTCTAGG - Intergenic
1140814486 16:78608606-78608628 CTGTGGAAGGGTCAAGTGCAGGG + Intronic
1141711385 16:85701219-85701241 CTCTGCAAGGTCCAGTTTCATGG - Intronic
1203146850 16_KI270728v1_random:1808439-1808461 CTGTGGCAGGGCCAGGTCCAGGG + Intergenic
1143248515 17:5505104-5505126 CTGTGGAAAGGGGAGATTCCTGG - Intronic
1143334795 17:6164160-6164182 CTGTGGGTTGGGCTGTTTCAAGG + Intergenic
1143435385 17:6920712-6920734 TTTTGGAAGGGTCAGTTCCATGG + Intronic
1144189489 17:12831374-12831396 AAGTGGTAGGGGCAGTTTAATGG + Intronic
1146101062 17:29982536-29982558 ATGTGGAAGGGGGAAATTCAGGG + Intronic
1146794502 17:35771914-35771936 CTGTGGAAGGGGAATTGTTAGGG - Intronic
1146929666 17:36768365-36768387 CTGTGGGAGGTGCAGCTTCCTGG + Intergenic
1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG + Exonic
1148997618 17:51724960-51724982 CTCTGGTAGGAGCAGTTTTATGG + Intronic
1149405379 17:56344790-56344812 CTCTGGAAGAGGCATTTTAAAGG + Intronic
1149531907 17:57402298-57402320 CTGTGGAAATGGCAGGTTCAAGG + Intronic
1150327038 17:64265481-64265503 CTTTGCAAGGGGCAGCTCCAGGG - Intergenic
1151400234 17:73851112-73851134 TTGTGGCAGGGGCAGCCTCAAGG - Intergenic
1153509808 18:5839263-5839285 CTGTGTAGGCAGCAGTTTCATGG - Intergenic
1154379768 18:13838471-13838493 CTGCGGAATGGTCAGTTTCACGG + Intergenic
1155181585 18:23352877-23352899 CTGAGGAAGGGGCAGCATCTTGG + Intronic
1155687552 18:28574190-28574212 CTCTGGCAGTGGCAGCTTCATGG - Intergenic
1157074760 18:44453458-44453480 CTGTGGAGGAGGCAGATTGACGG + Intergenic
1157747341 18:50147355-50147377 CTGTGGACAGGGCAGTGGCAGGG - Intronic
1159180368 18:64894220-64894242 CAGAGGTTGGGGCAGTTTCAAGG - Intergenic
1159438698 18:68449823-68449845 CTGGGGAAGGTGAAGTTTCATGG + Intergenic
1159587867 18:70299214-70299236 CTGAGGACGGGGCAGTCTCATGG - Intronic
1160234903 18:77078096-77078118 CAGTGGAAGATGCATTTTCATGG + Intronic
1160409992 18:78668624-78668646 CTGGGGAGGGGTCATTTTCAGGG + Intergenic
1160532980 18:79576437-79576459 CTGTGGAGCGGGCAGAGTCACGG - Intergenic
1161292162 19:3500435-3500457 CTGTGGATGGGGCGGGTTAAGGG - Intronic
1161769894 19:6225435-6225457 CTGGGGAAGAGGCCGGTTCATGG + Intronic
1161982863 19:7638922-7638944 CAGTGGGAGGGGCAGTTTCAAGG - Intronic
1162908772 19:13838618-13838640 TTGTGAAACGGGCAGTCTCACGG - Intergenic
1163958495 19:20665472-20665494 CTGTGGATTGCACAGTTTCATGG + Intronic
1166015185 19:39974235-39974257 AGGGGGAAGGGGCAGTTTCCAGG + Intronic
1166088041 19:40489814-40489836 CCGTGGAAGGGGCAGAGCCAGGG + Intronic
1166983663 19:46647506-46647528 CTGTGGATATGGCAGTTTCCAGG - Intergenic
1166992194 19:46699233-46699255 CTGAGGAAGTGGCAGTTGAAGGG - Intronic
1167897243 19:52591874-52591896 CTGTGGAAGTCTCAGTTTTATGG - Intergenic
1167905328 19:52655888-52655910 CTGTGGAAGTCTCAGTTTTATGG + Intronic
1167941796 19:52953082-52953104 CTGTGGAAGTCTCAGTTTTATGG + Intronic
1168379076 19:55905113-55905135 CTGTGGAAGGTGCAGGTGCAAGG + Intronic
925904947 2:8534829-8534851 CTGTGGAAGGAGCTGAGTCAGGG + Intergenic
926095209 2:10076998-10077020 ATGTGGAAGGGGCAGGTTTGGGG - Intronic
929085646 2:38164887-38164909 CTGGGGAATGGGGAGTCTCAGGG - Intergenic
929598643 2:43191517-43191539 CTGTGGAAGGGGCAGTGCACAGG - Intergenic
932018672 2:68060033-68060055 CTGTGGGAGGGGCAGGTTTGTGG - Intronic
932774850 2:74522098-74522120 CTAGGGAGGAGGCAGTTTCAAGG + Intronic
933694659 2:85208722-85208744 TTGTGGAAGGGACAATTCCAGGG + Intronic
934520071 2:95014520-95014542 CTGTCCAAGGGCCAGTGTCACGG - Intergenic
935914289 2:107932529-107932551 CTGTTGAATGGGCAGGCTCATGG + Intergenic
936595167 2:113840533-113840555 CTGTGGAATGGGCAGTTTTGGGG + Intergenic
937985027 2:127634573-127634595 CTGGGGAAGGGGAAGGTACAGGG - Intronic
940615811 2:156047637-156047659 CTGTGGAAAAAGCAGTTTCCCGG - Intergenic
940973058 2:159914421-159914443 CACTGGAAGGGCCAGCTTCATGG + Intergenic
942293004 2:174490007-174490029 CAGTGGGAGAAGCAGTTTCAAGG + Intergenic
946201919 2:218075550-218075572 CTGTAGAGGGAGCAGTATCAGGG + Exonic
948490247 2:238308216-238308238 CTGGGGGAGGGGCAGTGTCAGGG + Intergenic
948595397 2:239076328-239076350 CTGCGCAAGGGGCTGTGTCACGG + Intronic
1169029448 20:2396431-2396453 CTGGGGAAGGGGCTGCATCAGGG - Intronic
1169258946 20:4121253-4121275 CTGTGGGAGGGAGTGTTTCAGGG - Intronic
1169287445 20:4321486-4321508 CTGTGGGGGGTGCAGGTTCATGG + Intergenic
1169753808 20:9022820-9022842 CTGTGGATGGAGCAGGTTCAGGG - Intergenic
1171356012 20:24545999-24546021 CTGTGGAAGGGGCCATTTCTTGG - Intronic
1171406728 20:24916764-24916786 CTGTGGCTGGGTCAGTATCAGGG - Intergenic
1171406842 20:24917470-24917492 CTGTGGCTGGGTCAGTATCAGGG + Intergenic
1172292634 20:33787521-33787543 CTTTGGAAGGGGCTGTTTCTGGG - Intronic
1172519086 20:35555861-35555883 CTGTGGAAGGAGGAGTTTCTAGG + Intronic
1173914435 20:46696430-46696452 AAGTAGAAGGGGGAGTTTCACGG - Intergenic
1174013688 20:47471016-47471038 ATTTGGCAGAGGCAGTTTCAAGG + Intergenic
1174440644 20:50549528-50549550 CTGTGGCAGGGACAGTTACTTGG + Intronic
1175998386 20:62821400-62821422 CTGGGGAAAGGGCGGTTCCAGGG - Intronic
1177863866 21:26489043-26489065 ATGTGGAAATGGCAGTTTTAAGG + Intronic
1179810707 21:43867273-43867295 CTGTGGAGGTGGGAGTTCCAGGG - Intronic
1180716040 22:17873127-17873149 CTGTGGAATGCACAGTTCCAGGG + Intronic
1181267753 22:21640918-21640940 CTGGGGGAGGGGTAGTTTGAGGG + Intergenic
1182247359 22:28969766-28969788 CTGGGGAAGGGGCAGTGTCAGGG + Intronic
1182273662 22:29171520-29171542 CTGTGGAGGGGTCAGAATCAGGG - Intergenic
1182978580 22:34646725-34646747 TTGAGGAAGGGACAGTTTGAAGG - Intergenic
1183072055 22:35403105-35403127 CTGTGGTGTGGGCAGATTCAGGG + Intronic
1184989471 22:48157182-48157204 CTGAGGAAGGCACAGTTACAGGG + Intergenic
949782995 3:7711005-7711027 GTGTGACAGAGGCAGTTTCAGGG - Intronic
950121496 3:10485024-10485046 CTGTGAAAGGGGCTGGTTGAGGG + Intronic
952198154 3:31097659-31097681 CAGTGGATGGGGTGGTTTCAGGG + Intergenic
953556000 3:43947532-43947554 CTGTGGAAGGGGCAATATTAAGG + Intergenic
954579621 3:51696237-51696259 CTGTGGAAGGGGATGTGCCAGGG + Intronic
954802766 3:53196661-53196683 CCGAGGAAGGGGCAGGTGCATGG - Intergenic
955017538 3:55086951-55086973 CAGTGGAAGAGGCAGTGCCATGG - Intergenic
955046766 3:55368294-55368316 GTGTGGCAGGGGGAGTTCCAGGG - Intergenic
955059298 3:55482411-55482433 CTGTGGAAGGGGCTCCTTCAGGG - Intronic
955849350 3:63203469-63203491 CTGTGGCATTGGCAGATTCAAGG - Intergenic
956394251 3:68808237-68808259 CAGTGGAAGGGTCATTTTTAGGG - Intronic
957596754 3:82276760-82276782 CTATGAAAGGGTCACTTTCATGG + Intergenic
959478406 3:106839824-106839846 CTCTGGAAGGTGCATTTACAGGG + Intergenic
959620802 3:108396907-108396929 TTCTGGAAGGGGCAGTTCCTTGG + Intronic
960054979 3:113270778-113270800 CTGTGGAAAGGGCAGGGCCAGGG - Intronic
961531318 3:127542143-127542165 CTGTGGAAGGGCCAGGTGCTGGG - Intergenic
961998534 3:131271157-131271179 GTGTGGAAGGGGCAATCTCCAGG + Intronic
962961494 3:140315258-140315280 TTTTGGAAGGGTCTGTTTCAAGG - Intronic
963235875 3:142955350-142955372 ATGTGGAAAGTGAAGTTTCAAGG + Intronic
966638113 3:182158048-182158070 CTGTGGAAAGGGTAATTACAGGG + Intergenic
970573442 4:17404901-17404923 CTGGGGCAGGGGCAGCTGCATGG - Intergenic
971699580 4:29952936-29952958 CTCTGGAAGGGGCAGAATTATGG + Intergenic
972766930 4:42159876-42159898 CTGTGGAGGGGGCAGTCTTGGGG - Intergenic
976538354 4:86243591-86243613 CTGAGGAAAGGGCATGTTCAAGG - Intronic
976852262 4:89561031-89561053 CTGTTGAAAGGGCAGTTTTGGGG - Intergenic
981721554 4:147806905-147806927 GGGTGGCAGGGGCAGTTTCGTGG - Intronic
983796949 4:171875682-171875704 CTGTGGAATGGGCAATTACTGGG + Intronic
983908234 4:173206721-173206743 CTGTGGAGGGTGCAGACTCAAGG - Intronic
984542473 4:181057239-181057261 ACGTTCAAGGGGCAGTTTCATGG - Intergenic
985790874 5:1926351-1926373 CTGGGGCAGGGGCAGGTGCAGGG - Intergenic
986583169 5:9286569-9286591 CTCTTGAAGGGGTAGTTTCCTGG - Intronic
987544684 5:19298076-19298098 CTGAGGAAAGCTCAGTTTCAAGG - Intergenic
987609345 5:20181637-20181659 CTGTGGAAATGGCAGCTTCATGG + Intronic
990812992 5:59749908-59749930 TTGTGGAAGGAGCATTTTTAGGG - Intronic
992002834 5:72452179-72452201 GTGCGGGAAGGGCAGTTTCACGG - Intronic
993260574 5:85653991-85654013 CTGTGTAAGGATCAGTTGCAGGG - Intergenic
993260889 5:85656479-85656501 CTGTGTAAGGATCAGTTGCAGGG - Intergenic
995909009 5:117163305-117163327 CTGTAGAAGCAGAAGTTTCATGG + Intergenic
996083639 5:119282428-119282450 CAGGGGAAGGGCCCGTTTCAAGG - Intronic
996773578 5:127110410-127110432 CTACAGAAGGAGCAGTTTCAGGG - Intergenic
999806303 5:155084623-155084645 TTCTGGAAAGGGCATTTTCAGGG - Intergenic
1002042134 5:176522054-176522076 CTTTGGGAGGGCCAGTTTCCTGG + Intergenic
1002407550 5:179047765-179047787 CTGATGAAGGGGCAGTCTTACGG - Intergenic
1002914765 6:1520112-1520134 CTGGGGAAGGGTCTCTTTCAGGG - Intergenic
1003038664 6:2667458-2667480 CTTTGGAAGGGGCAATTAGATGG - Exonic
1003124074 6:3341353-3341375 CAGTGCAAGAGGCTGTTTCAAGG + Intronic
1004140340 6:13012368-13012390 TTGTGGAAGAGGCAGTGACAGGG + Intronic
1006060299 6:31414138-31414160 CTGTGGCAGTGGCAGTTCCCAGG + Intronic
1006072742 6:31508904-31508926 CTGTGGCAGCGGCAGTTCCCAGG + Intronic
1006349265 6:33509148-33509170 CTGTGGGAGGAGCAGGTTTATGG - Intergenic
1006579643 6:35069319-35069341 CTGTGGATGGGGCAGGGACAAGG - Intronic
1006926299 6:37657353-37657375 CTGTGGAAGGGGCAGAATGATGG - Intronic
1007232845 6:40360697-40360719 CTATGGAAGGTTCAGTTTCAAGG - Intergenic
1007655583 6:43449333-43449355 CTGTGGTAGGGGCTGTTGCTTGG + Intronic
1008872762 6:56291282-56291304 CTGAGAAAGGGGCAGTTTCTTGG + Intronic
1010666692 6:78639261-78639283 CTTTGGGGAGGGCAGTTTCATGG - Intergenic
1010745934 6:79561693-79561715 GTGTGCAAAGGGCAATTTCATGG - Intergenic
1011793382 6:90925024-90925046 TTGAGGAAGGAGCTGTTTCATGG + Intergenic
1015944504 6:138486387-138486409 CCTTTGAAAGGGCAGTTTCAAGG - Intronic
1018041918 6:159932248-159932270 CTGAGGAAGGGGCACCTTCCTGG - Intergenic
1018681345 6:166268580-166268602 CTATGGAAGGGGCAGTACCCGGG + Intergenic
1018690441 6:166339983-166340005 CTGTGGGAGGAGCAGGTTCAGGG - Intronic
1018785983 6:167108382-167108404 CTGGAGAAGGGGCTGTGTCAGGG - Intergenic
1019050385 6:169178718-169178740 CTGTGGACGCGACAGCTTCAGGG - Intergenic
1019357354 7:587630-587652 CTGTGGAAGGGGCTGTGTGGTGG - Intronic
1019621351 7:1993966-1993988 CTGTGGCCAGGGCAGTTGCAGGG - Intronic
1019812829 7:3177052-3177074 CTGAGGGAGGAGCTGTTTCATGG - Intergenic
1020030066 7:4926443-4926465 CTCTGCAAGGGGCAGCTTGAAGG + Intronic
1020624718 7:10563637-10563659 TTGTGGAAATAGCAGTTTCAAGG + Intergenic
1022547736 7:31204370-31204392 CTTTGGGTGAGGCAGTTTCAGGG + Intergenic
1024240743 7:47433677-47433699 CTGTGGAAAGTGCAGGTTCTAGG - Intronic
1025160312 7:56653708-56653730 CTGTGGGTGTGGCGGTTTCAAGG - Intergenic
1029479257 7:100802968-100802990 CTGGGGGAGGGGCATTTACAAGG + Exonic
1029763657 7:102613736-102613758 CTGTGGAAGGAGGAGGATCAGGG + Intronic
1030869927 7:114743028-114743050 CTGTGGAAGCGCCAGTTTCTGGG + Intergenic
1031215773 7:118888658-118888680 GTGTGGGGGGGGTAGTTTCATGG - Intergenic
1034477431 7:151293936-151293958 CTGTGGATGGTGCAATGTCAGGG + Intergenic
1036768023 8:11561186-11561208 CTGGGGAAGGAGCTGTTTCTTGG - Intronic
1037759537 8:21732853-21732875 CTGAGGAATGGGCACTTCCAAGG + Intronic
1039185672 8:34913488-34913510 CTGTGGAAGGTGGTGTCTCATGG + Intergenic
1040389050 8:46933886-46933908 CTTCGGAAGGGCCAGTTACAGGG - Intergenic
1042587652 8:70359553-70359575 CTCTTGAAGGGGAAGTTACAAGG + Intronic
1043908552 8:85834450-85834472 CATTGGAAGGGTCACTTTCAGGG - Intergenic
1044128480 8:88489627-88489649 CTGTGGAAAGGGGAGTTTTCTGG - Intergenic
1045126147 8:99091102-99091124 CTGTGGCTGGGGCAGTATCATGG + Intronic
1046019937 8:108652677-108652699 CTGTGTTAGGGGCAGATTCCTGG - Intronic
1046143642 8:110127882-110127904 ATGTGCAAGGTACAGTTTCATGG + Intergenic
1047364951 8:124203209-124203231 CTGTGGAATCGGCCATTTCATGG + Intergenic
1048498093 8:134951924-134951946 CTCTGGAAGGCGCAGCATCAGGG + Intergenic
1049222774 8:141435449-141435471 CCGTGGAAGGGGCAGGGCCAGGG - Intergenic
1049241846 8:141541799-141541821 CTGGCGATGGGGCAGTATCAGGG + Intergenic
1049831766 8:144705311-144705333 CTGTGGAAGGGGCAGCTAGTGGG - Intergenic
1050056384 9:1659920-1659942 CTGTGGCAGGGGCAGTGCCTGGG - Intergenic
1051026257 9:12615325-12615347 CTGTGGAAGTGGCAGTTAATAGG + Intergenic
1051543470 9:18247830-18247852 ATGTGGAAAGGGCAGCTTCTAGG + Intergenic
1051684741 9:19646340-19646362 TTGTGGCAAGGGCAATTTCAGGG - Intronic
1054456662 9:65434691-65434713 CAGTGGGAGGGGCAGTCCCATGG + Intergenic
1055416743 9:76091923-76091945 GTCTGGAAGGGACATTTTCAGGG + Intronic
1059451360 9:114373072-114373094 CTGTGGCAGGGGCAGGGTCCTGG + Intronic
1059659326 9:116385992-116386014 CTGAGGAAGGGACATTTACATGG + Intronic
1059694425 9:116717320-116717342 TTGTGGAAACGGCAGTCTCATGG + Intronic
1061020586 9:128011880-128011902 CTGAAGAAGGGCCAGTTTCCGGG - Intergenic
1061147859 9:128810174-128810196 CTGGGGAAGGGACATTATCAGGG - Exonic
1061751423 9:132780130-132780152 AAGTGGGAGGGGCTGTTTCACGG + Intronic
1062171779 9:135138723-135138745 CTGTGGAGGGAGCGGTTTCCAGG - Intergenic
1062197669 9:135283140-135283162 CTGGGGAAGGGGCAGGGTCAGGG + Intergenic
1062359076 9:136178911-136178933 CCCTGGAAGTGGCAGTTTGAGGG - Intergenic
1062666841 9:137678289-137678311 CTGTGGAAGTGGCACCTCCATGG + Intronic
1186562838 X:10630991-10631013 CTGTGGGAGGGGCAGTCTGGAGG + Intronic
1187362520 X:18641678-18641700 CTGTGAAAGGTGCAGTCTCAGGG - Exonic
1190266638 X:48831060-48831082 CTGTGTGAGTGGCAGTTTCTAGG - Intergenic
1192144231 X:68670380-68670402 CAGTGGAAAGGGCAATTTCAAGG + Intronic
1197229886 X:123992512-123992534 CTGTAGTAGGGAGAGTTTCATGG + Intronic
1198438066 X:136636351-136636373 CAGGGGAAGGGGCAGCTTTAGGG + Intergenic
1198654491 X:138898805-138898827 CTGTGCAATTGGCAGTTTGAGGG + Intronic
1198865890 X:141122468-141122490 CTCTGGAAGATGCAGTTACAGGG - Intergenic
1201015928 Y:9601316-9601338 CTCTGGAAGATGCAGTTACAGGG - Intergenic