ID: 1122539083

View in Genome Browser
Species Human (GRCh38)
Location 14:102486871-102486893
Sequence GGGAAGAATAGACCAGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 300}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122539081_1122539083 -10 Left 1122539081 14:102486858-102486880 CCCATCTGAAATTGGGAAGAATA 0: 1
1: 0
2: 3
3: 31
4: 437
Right 1122539083 14:102486871-102486893 GGGAAGAATAGACCAGAAGCAGG 0: 1
1: 0
2: 2
3: 36
4: 300
1122539078_1122539083 19 Left 1122539078 14:102486829-102486851 CCTATTAACATGGGTATCGGGTT 0: 1
1: 0
2: 0
3: 2
4: 42
Right 1122539083 14:102486871-102486893 GGGAAGAATAGACCAGAAGCAGG 0: 1
1: 0
2: 2
3: 36
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122539083 Original CRISPR GGGAAGAATAGACCAGAAGC AGG Intronic
900844631 1:5087025-5087047 GGGAAGATGAGACCTGGAGCAGG + Intergenic
902710794 1:18238420-18238442 GGGAAGAGGAGATAAGAAGCAGG + Intronic
904311010 1:29629654-29629676 GGGAAGCAGAGAACAGAATCTGG - Intergenic
905269643 1:36779014-36779036 GGGAAGAATAGCCAAGAGGAGGG + Intergenic
905863620 1:41365548-41365570 GAGAAGACAAGACCAGCAGCAGG + Intronic
905923325 1:41733235-41733257 GGGAAGATGAGAACACAAGCAGG + Intronic
905958418 1:42021148-42021170 GTGTAGAATAGACCATAAGGGGG + Intronic
907348783 1:53807979-53808001 GGGAAGAACAGACCTAAATCGGG + Intronic
907882828 1:58567003-58567025 GGTATAAATAGACCATAAGCAGG - Intergenic
908082828 1:60598712-60598734 AGGAAGAATAGAAAAGAAGTAGG + Intergenic
909214252 1:72866109-72866131 GGAAAGAATGGACCAGAAGCAGG - Intergenic
910558663 1:88565977-88565999 GGAGAGAAAAGACCAGAAGGAGG + Intergenic
911274242 1:95841108-95841130 GGAAAGAAGACACCAGAAGCAGG - Intergenic
911455758 1:98121249-98121271 GGAAAGAATAGGCCTGAATCTGG - Intergenic
912468152 1:109888101-109888123 GGGAAGAATGGGCCAGAAACAGG + Intergenic
914263131 1:146016096-146016118 GGGAGGATGAGACCAGAAACAGG + Intergenic
916521421 1:165566982-165567004 GTGAAGAAGAGACCAGAGGGAGG + Intergenic
916682228 1:167115162-167115184 GGGAAGAATAGAAAAGAGCCAGG - Intronic
916742044 1:167654706-167654728 GGGCAGAATAGACAAGAGGAAGG + Intronic
917554641 1:176070956-176070978 GAGAAGAATTGGACAGAAGCAGG - Intronic
919196081 1:194287871-194287893 GGGAAGAATAGGCTAGGAGTTGG + Intergenic
920074385 1:203325875-203325897 GGGGAGACTACACCAGAGGCAGG + Intergenic
920499033 1:206474738-206474760 GGGAAGGCCAGGCCAGAAGCTGG + Intronic
920542541 1:206790390-206790412 GGGAAGGAATGACCATAAGCAGG - Intergenic
921300637 1:213748442-213748464 TGGCAGAATAGTCCTGAAGCTGG + Intergenic
921824347 1:219655376-219655398 GGGAAGAAGAGAGCAGGAGGAGG - Intergenic
922227052 1:223654594-223654616 GGGGTGAACAGAGCAGAAGCTGG + Intronic
922352005 1:224742021-224742043 GGGAAGAAGAGAGGAAAAGCAGG + Intergenic
924036981 1:239947794-239947816 AGGAAGAAGAGAGCAAAAGCAGG + Intergenic
924940302 1:248808709-248808731 GGGAAGAAGAGATGAGAAGTGGG - Intergenic
1066190096 10:33048236-33048258 GGGAAGAATACACAAGCAGCCGG - Intergenic
1067231609 10:44415927-44415949 GGGAATAATAAACAAGAAGTGGG - Intergenic
1067913798 10:50374810-50374832 GGGAAGAATATTCCAGAAGAAGG - Intronic
1069682751 10:70296856-70296878 GTGAAGAACAGACCCAAAGCGGG + Intergenic
1071554183 10:86589786-86589808 GGGAAGAGTAGACCAAAAAGAGG - Intergenic
1072354418 10:94593172-94593194 GGGGAGAATTGACTAGAAGGGGG - Intronic
1072407570 10:95169067-95169089 GGAAAGATCAGCCCAGAAGCAGG - Intergenic
1073106195 10:101033427-101033449 GGGAAGGGAAGACCAGAAACAGG - Intronic
1073284245 10:102377795-102377817 TGGAAGGATAGACAAGAAACTGG - Intronic
1074033885 10:109718327-109718349 GGGAAAAAAAGAACAGAAACAGG + Intergenic
1076544660 10:131237158-131237180 GGGAAGAATATTCCAGCAGAGGG - Intronic
1079763881 11:24365456-24365478 GAGAAGAATACAACAGAAGCAGG - Intergenic
1081150952 11:39631042-39631064 GGGAAGCAAAAACCAGAAACTGG - Intergenic
1081846240 11:46242631-46242653 AGGAAGAATGGCCCAGAGGCCGG + Intergenic
1084345766 11:68547435-68547457 GAGCAGAAGAGACCAGCAGCAGG + Intronic
1085029313 11:73259988-73260010 GAGGAGAACAGACCAGAACCTGG - Intergenic
1085771461 11:79329751-79329773 GGGAAGATGAGATCAGAAGTTGG + Intronic
1086994475 11:93340580-93340602 GGGAAGAATAGACCATAGGAGGG + Intronic
1089355611 11:117850283-117850305 GGGCAGAACAGACCTGAAGCTGG + Intronic
1089646347 11:119882356-119882378 GGGAGGAATAAACAAGAAGTGGG - Intergenic
1090429608 11:126635009-126635031 GGCAAGAAGAGCCCAGAAGCTGG - Intronic
1090458066 11:126866698-126866720 GGGAGGAATACACCAGCAGAAGG + Intronic
1091148754 11:133305671-133305693 GGGAAGAAGAGAGCAGATGCTGG - Intronic
1091904187 12:4169838-4169860 AGAAAGAAAAGACCAGAAGATGG + Intergenic
1092776665 12:11949860-11949882 TGGAAGGAGAAACCAGAAGCAGG + Intergenic
1094069316 12:26395517-26395539 TGGAAGAATGGACCAGAGGCTGG - Intronic
1095292457 12:40491158-40491180 GGGAAGACTAGATCATCAGCTGG + Exonic
1095560773 12:43562688-43562710 GGAAAGAATAGACTAGTAGTAGG + Intergenic
1096012920 12:48236964-48236986 AGGTAGAACAGACCAGAACCTGG - Intergenic
1097029547 12:56081118-56081140 GGAGAGAAAAGACCAGAGGCTGG - Intronic
1098632649 12:72742554-72742576 GGAAAGAAAAGACCATAATCAGG + Intergenic
1099591377 12:84595354-84595376 GGAAATAATAGACCAAAATCTGG + Intergenic
1099940494 12:89182441-89182463 GGGAAGAATATTCCAGAAAAAGG - Intergenic
1100985389 12:100198401-100198423 GGGAAAAATAATGCAGAAGCAGG - Intergenic
1101452103 12:104789133-104789155 GGGAAGTATAGGCCAGATGAAGG + Intergenic
1101970779 12:109310329-109310351 GCGAAGAAGAACCCAGAAGCAGG - Intergenic
1103246956 12:119466059-119466081 GGGAAGAGTATTCCAGTAGCAGG - Intronic
1103356723 12:120327032-120327054 GGGAAGAATAGAGCAGGATGAGG + Intronic
1103657572 12:122485625-122485647 GGGAAGACTAGAGGAGGAGCAGG - Intronic
1103725367 12:122995111-122995133 GGGCAGAATGGACCAGGGGCAGG - Intronic
1104260489 12:127177638-127177660 GGAAAGACTAGACAAGAAGTGGG + Intergenic
1104363854 12:128158880-128158902 GGGAAGAAAAGAAGAGAAGAAGG + Intergenic
1108341038 13:49498009-49498031 AGAAAGAATAGAGCAGAAGGAGG - Intronic
1109242045 13:59901435-59901457 GGTAAGAGTTGAGCAGAAGCCGG - Intronic
1109421248 13:62115445-62115467 AGGAAGAAGACACCAGAAGCTGG + Intergenic
1111698993 13:91662112-91662134 GGGAAGAAGAGAACTGAGGCAGG + Intronic
1112224084 13:97520398-97520420 GGTAAGAAGAGACTAGAAGTAGG + Intergenic
1113124695 13:106964162-106964184 GGGAGGAATTGACCAGTTGCGGG - Intergenic
1114207992 14:20591176-20591198 GGGAAGAATAGATGAGTAGAAGG - Intronic
1114465262 14:22917924-22917946 GGGAAGAATTCACGAAAAGCTGG + Intronic
1114852584 14:26399041-26399063 GGGAAAAATATACCAGAGACAGG - Intergenic
1117393849 14:55289478-55289500 CGGAAGAATAGATAAGAAACTGG - Intronic
1117697024 14:58376009-58376031 GGCAAGAGTAGACCTGATGCAGG + Intergenic
1118632744 14:67721216-67721238 CAGAAGAATAGACAAGGAGCTGG - Intronic
1118968819 14:70613946-70613968 GGGAGAAATAAACCAGAAGCAGG - Intergenic
1119899620 14:78248794-78248816 GGGAAGGAGAGAACAGAAGCAGG + Intronic
1121960301 14:98253463-98253485 GGAAAGAATGTACCAGAAGCAGG + Intergenic
1122539083 14:102486871-102486893 GGGAAGAATAGACCAGAAGCAGG + Intronic
1124507513 15:30291187-30291209 GGGAAGAATAGCCTCGAAGCAGG + Intergenic
1124708616 15:31986087-31986109 GGGCAGAACAGACAGGAAGCGGG + Intergenic
1124736042 15:32247472-32247494 GGGAAGAATAGCCTCGAAGCAGG - Intergenic
1126772268 15:52070278-52070300 GGTGAGAAAGGACCAGAAGCTGG - Intergenic
1127170368 15:56294293-56294315 GGAAGGAAAAGACAAGAAGCAGG - Intronic
1127245940 15:57174803-57174825 GGGAAGAATGTAACAGAAGATGG + Intronic
1127259371 15:57317042-57317064 GGGAAGGAGAGAGCAGAAGTGGG - Intergenic
1128095851 15:64954930-64954952 GAGAAGAAGAGACAAGAAGAAGG - Intronic
1128525633 15:68410463-68410485 AGGGAGAAAAGACCATAAGCTGG + Intronic
1128720783 15:69946923-69946945 GAGAAAAATAGAGCAGTAGCTGG + Intergenic
1128790160 15:70427378-70427400 GGCAAGAATACACCAGCAGGAGG + Intergenic
1129103324 15:73286693-73286715 GGGAATAAAGGAGCAGAAGCGGG - Intronic
1129394752 15:75237675-75237697 GGGAGGAGCAGAACAGAAGCAGG + Intergenic
1129697824 15:77750579-77750601 GGGTGGACCAGACCAGAAGCAGG - Intronic
1131194357 15:90343506-90343528 GGGAAGCAGAGGGCAGAAGCTGG - Intergenic
1133119573 16:3597796-3597818 GAGAGGATAAGACCAGAAGCAGG - Exonic
1133720374 16:8489011-8489033 GGCATTAATAGAACAGAAGCAGG + Intergenic
1133920426 16:10147856-10147878 GGAAAGAATAGCACAGAAGTAGG - Intronic
1134075422 16:11287632-11287654 GGAAAGAAAAGCCCAGAACCTGG - Intronic
1134533280 16:15002343-15002365 TGGAAGAATACACAAGAAACTGG - Intronic
1135238748 16:20783748-20783770 AGGGAGAATAGACAAGAAACTGG - Intronic
1135404576 16:22189243-22189265 GGGAAGAATCCACCAGCTGCTGG - Intronic
1137556656 16:49474564-49474586 GGGAAGAAGAGGCAAGAAGTTGG - Intergenic
1137903132 16:52290829-52290851 AGGAAGAATAGTCCAAAAGAAGG + Intergenic
1138300044 16:55918453-55918475 GGGAAGAATAGAACATAGGCAGG - Intronic
1138461526 16:57151138-57151160 GGGAAGCATACAGCAAAAGCTGG + Intergenic
1139862753 16:70038396-70038418 TGGAAGAATACACAAGAAACTGG + Intergenic
1140365415 16:74377290-74377312 AGGAAGGAGAGCCCAGAAGCAGG + Intergenic
1142037548 16:87871009-87871031 GGGAAGAATAGGGCAGATGGAGG - Intergenic
1144455382 17:15414313-15414335 GGGAAGCATAGCCTTGAAGCAGG - Intergenic
1148745378 17:49915157-49915179 GGCAAGAAGAGGCCAGAGGCAGG - Intergenic
1149389741 17:56176800-56176822 AGGAAAAATAGAACATAAGCTGG - Intronic
1151471102 17:74318299-74318321 GTGGAGAATAAACCAGATGCAGG + Intergenic
1152124416 17:78437820-78437842 GGGAACACTGGACAAGAAGCTGG - Exonic
1152311818 17:79556114-79556136 GGGAAGCAAAGACCAGGATCAGG + Intergenic
1152341805 17:79729761-79729783 GTGAAGGATAGACCAGAACGAGG - Intergenic
1155036692 18:22030524-22030546 GGGAAGAAGAGACCAGCTGAAGG + Intergenic
1155997488 18:32345612-32345634 GGGCAGATTTGACCAGAAACTGG - Intronic
1156399374 18:36727021-36727043 GGAGAGAAGAGATCAGAAGCAGG + Intronic
1157684129 18:49629241-49629263 GGGAACAATTGGGCAGAAGCAGG + Intergenic
1158848569 18:61470580-61470602 GGGAAAAAGAGACAAGAACCTGG + Intronic
1158978726 18:62737740-62737762 AGGAAGAGTAGACCAGGAGCTGG + Intronic
1162124074 19:8490030-8490052 GGAAAGAAAAGACAAGAAGCAGG + Intergenic
1164540570 19:29118742-29118764 TGGAAGGATAGACTTGAAGCAGG + Intergenic
1165679539 19:37762095-37762117 GGGAAGAATAGAACATCACCTGG + Intronic
1167067009 19:47193964-47193986 GAAAAGCATAGCCCAGAAGCAGG + Intronic
1168366656 19:55793647-55793669 GGGTACACTAGACCAGAGGCTGG + Intronic
1168546808 19:57259332-57259354 GGGAAAAATAGACCAGAAAAAGG - Intergenic
926892225 2:17648705-17648727 GGGAAGCATAGACCACAAGGAGG - Intronic
928342271 2:30454967-30454989 GAGAAGAATATACTAGAAGTCGG + Intronic
928498148 2:31856591-31856613 GGGAAGAATTGGGTAGAAGCTGG + Intergenic
929040051 2:37735974-37735996 GGGAGGAATACACCAGGACCAGG - Intronic
929562293 2:42963463-42963485 GGGAGGAAGTGGCCAGAAGCAGG - Intergenic
929732612 2:44511751-44511773 GGGAAGAACAGTCCAGGAGGAGG - Intronic
930845526 2:55899614-55899636 AGCAAGAATTGACCAGAAACAGG + Intronic
931017844 2:58006316-58006338 GTGAAGAATGGACCAAAAGGTGG + Intronic
931496261 2:62810408-62810430 GGGAAGAAGAGTCCAGATTCTGG + Intronic
933806367 2:86000848-86000870 GGGAAAAAGAGACCAGAGACAGG - Intergenic
934537451 2:95147122-95147144 GAGAAGCCTAGACCAGGAGCTGG - Intronic
934734793 2:96684580-96684602 GAGAAGAATGTGCCAGAAGCAGG + Intergenic
935078827 2:99772137-99772159 AGGAAGAATAAACAAGAAGTGGG + Intronic
935503472 2:103870020-103870042 GGGAAAAAAAAACCAGAGGCGGG - Intergenic
936263321 2:110980435-110980457 GGGAAGAAGAGACCCCAAGAAGG + Intronic
936748125 2:115605407-115605429 GGGAAATATATACCAAAAGCAGG - Intronic
937649656 2:124306028-124306050 CGGAATTATACACCAGAAGCAGG - Intronic
938950493 2:136250326-136250348 AGAAAGAATAGATCAGGAGCTGG - Intergenic
940805331 2:158180727-158180749 GGGAGGAATACCCCAGAAACAGG + Intronic
941102947 2:161317460-161317482 GGGTGGAATAGACTGGAAGCGGG + Intronic
941934834 2:170974219-170974241 GGACAGAATAGCCCAGAGGCCGG + Intergenic
942364314 2:175207331-175207353 GGGAAGAAGATACAAGGAGCAGG + Intergenic
943527220 2:189031421-189031443 GAGAAGAATGGATCAGAAGAGGG + Intergenic
943889385 2:193267124-193267146 GGTTATAATAAACCAGAAGCTGG - Intergenic
946017537 2:216615951-216615973 GGGAAGGAGAGACCAGACTCAGG + Intergenic
946367770 2:219260618-219260640 GGGAAGCCTAGAACAGAAGCAGG - Intronic
947002120 2:225468465-225468487 AGGAAGAATAGACAAGAAACAGG + Intronic
947097345 2:226581162-226581184 GGGAAGACTAGAGCAGCAGGGGG - Intergenic
947261478 2:228228211-228228233 AGGAAGAATAGACTAGAAAGAGG + Intergenic
947664544 2:231895500-231895522 GGCAAGAATGGTCTAGAAGCAGG + Intergenic
948202348 2:236138346-236138368 GGGAAGCATAGGCTAGAAGATGG - Intergenic
1169182817 20:3585012-3585034 AGAAGGAATAGACCAGAAGCTGG + Intronic
1169745388 20:8937318-8937340 GAGAAGAAAAGCCGAGAAGCGGG - Intronic
1169973290 20:11294992-11295014 GGGAAGAACATACCAGGAACAGG - Intergenic
1170012721 20:11744333-11744355 GAAAAGAATAGACCAGAATAGGG - Intergenic
1170353836 20:15470701-15470723 GAGAAGAATAGGCAAGAAGGTGG - Intronic
1172022915 20:31927183-31927205 TGGAAGAACAGACAAGAAGCTGG + Intronic
1173144208 20:40510835-40510857 GGGAGGAAGAGAGGAGAAGCAGG + Intergenic
1173334543 20:42101993-42102015 GGGACTAGTAGATCAGAAGCAGG + Intronic
1173902074 20:46598255-46598277 GGAAGGCAAAGACCAGAAGCAGG + Intronic
1175551812 20:59822368-59822390 GGGAAGAACAAAGCAGATGCGGG + Intronic
1175796440 20:61774174-61774196 GGGAAGAATGCAGCAGAGGCTGG - Intronic
1176057273 20:63155397-63155419 GGGAAGAAGAGGCCGGAAGAAGG - Intergenic
1177010287 21:15723978-15724000 AGGAAGACAAGACAAGAAGCAGG - Intergenic
1178133646 21:29601562-29601584 GGGATGAATAGCACAGAGGCTGG - Intronic
1178379306 21:32094536-32094558 GGGAAGAATTGAGGAGAAGAGGG - Intergenic
1178779532 21:35588304-35588326 GGTAAGAACAGACCAAAAGAAGG - Intronic
1178877102 21:36421962-36421984 GGGAAGAGAAGACCTGGAGCAGG - Intergenic
1179785329 21:43726716-43726738 GGGAAAAATAGATCAGAAAATGG - Intronic
1181881060 22:25980376-25980398 AGAAAGGAAAGACCAGAAGCAGG + Intronic
1182228635 22:28819671-28819693 GCAAACAATAGCCCAGAAGCCGG + Intergenic
1182793356 22:32971843-32971865 GGGAAGAAAAGAAAGGAAGCAGG + Intronic
1184085013 22:42256107-42256129 GGGAAGAATATTGGAGAAGCCGG - Intronic
1203292326 22_KI270736v1_random:7523-7545 GGGAGGAATACACCAGGACCAGG - Intergenic
949945924 3:9190121-9190143 GGCAAGAATAGAACAGAACTGGG + Intronic
950794772 3:15501851-15501873 GGGAATTATAGCCAAGAAGCAGG - Intronic
951765805 3:26197335-26197357 GGGAAAAAGAGATCAGAAGAAGG - Intergenic
952019448 3:28999408-28999430 GGTAGGAATAGATCAGAACCTGG + Intergenic
953339130 3:42119031-42119053 GGGAAGGAGAGAGCAGCAGCCGG - Intronic
954169395 3:48788515-48788537 GAGAAGAATAGAGAAGAAACAGG + Intronic
955742178 3:62103041-62103063 AGGAAGAAAAGAAGAGAAGCAGG - Intronic
956262388 3:67358286-67358308 GGGAAGATTATACAAGAAGGTGG + Intergenic
956384871 3:68705720-68705742 GGGAAGAATGAACCAGAAGTAGG + Intergenic
956897133 3:73674032-73674054 GGGCAGAATAGAGCAGCAGGAGG + Intergenic
957955927 3:87186997-87187019 GGGAAGGAGAGACATGAAGCTGG + Intergenic
958536761 3:95414046-95414068 GCAAAGAAAAGACCAGGAGCTGG + Intergenic
959752534 3:109855475-109855497 GGGAGAAATAGGCCAGAAGAGGG + Intergenic
962842115 3:139243605-139243627 GAAAAGAATAGAACAGAAGGAGG - Intronic
965511699 3:169574981-169575003 GGGAATAATACAACCGAAGCAGG + Intronic
965973736 3:174595248-174595270 GGAAAAAAGAGACAAGAAGCGGG - Intronic
966118111 3:176489321-176489343 GGGAAGAAGAGACAAGAAGGGGG + Intergenic
966883512 3:184362384-184362406 GGGAAGGATAGAACAGAGGGCGG + Intronic
966923712 3:184630906-184630928 AGGAAGAACAGGCCAGAAACTGG + Intronic
967441287 3:189511961-189511983 GGGAAACATAGACCTGAAGAAGG + Intergenic
968086868 3:195877759-195877781 GGGAAGAGAGGACCAGAGGCTGG + Intronic
970016008 4:11513446-11513468 GAGAAGAAAAGGCCAGATGCAGG + Intergenic
970833688 4:20373847-20373869 GGGAAGGCTAAACAAGAAGCAGG + Intronic
971513942 4:27463629-27463651 GGGAAGACCAGATCAGAAGTAGG + Intergenic
971546069 4:27889246-27889268 GGGAGGAATAGAAGAGAAGGAGG - Intergenic
972973965 4:44610559-44610581 GGCAAGAAAACACCAGAAGGTGG + Intergenic
974208392 4:58737523-58737545 GAGAAGGAGAGAACAGAAGCAGG + Intergenic
976067029 4:81199439-81199461 GGAATGAATAGAGCAGAATCTGG + Intronic
977381321 4:96278083-96278105 GGGTATAATAGACTAGAGGCAGG - Intergenic
977481441 4:97582131-97582153 GGGAACCATAGAGCAGAAGTAGG - Intronic
977930977 4:102748519-102748541 TGGAAGAATACACAAGAAACCGG + Intronic
978763845 4:112384160-112384182 GGGAAGAACAGACCAGTAAGTGG + Intronic
979061772 4:116071019-116071041 GGGGAGAATAGAGGAGAAGGGGG + Intergenic
979421177 4:120507174-120507196 GAGAAGAATAGATCAAAATCTGG - Intergenic
980846171 4:138327892-138327914 GGGAAGAACAGACAAGAAAAGGG - Intergenic
983682562 4:170370798-170370820 TGGAAGAATACATAAGAAGCTGG - Intergenic
984450625 4:179896862-179896884 AGGAAGAAAAGACTAGAAGTAGG + Intergenic
984450715 4:179897777-179897799 AGGAAGAAAAGACTAGAAGCAGG + Intergenic
986008246 5:3685992-3686014 GAGAAGAATATAGAAGAAGCTGG - Intergenic
986164522 5:5262336-5262358 GGAAAGAGTAGAAAAGAAGCAGG + Intronic
988696076 5:33623844-33623866 GGAGAGAAGAGATCAGAAGCTGG - Intronic
988892079 5:35628879-35628901 GTAAAGAGTAGTCCAGAAGCGGG - Intronic
989185811 5:38624753-38624775 GACAAGAATAGACCAGCCGCCGG - Intergenic
989329305 5:40237394-40237416 GGGAAGAACAATCTAGAAGCTGG + Intergenic
989451556 5:41592437-41592459 GGGAAGAATGCATAAGAAGCAGG + Intergenic
990511815 5:56496193-56496215 TGGAAGAATATACAAGAAACTGG + Intergenic
990764537 5:59167631-59167653 AGGAAGAATGGAGCAGATGCAGG - Intronic
991956318 5:71998796-71998818 GGTAAGAATAGAGGAGAAGGAGG + Intergenic
993153607 5:84192899-84192921 GTGAAGCATAGACTAGAAGCCGG + Intronic
995021697 5:107373910-107373932 GGGAAGAAGAGGCCAGCACCAGG - Intergenic
995516630 5:112960620-112960642 TGGAAGAAGAGAGAAGAAGCAGG - Intergenic
996328702 5:122306430-122306452 GGGAAGAATAGACAAGTTACAGG + Intergenic
997364913 5:133319487-133319509 GGGAAGAGCAGGCCAGGAGCAGG + Intronic
997428553 5:133821552-133821574 GGGAACAAGAGTCCAGAGGCAGG + Intergenic
998410200 5:141904212-141904234 GGGAAGAGTAGACCAGAAGGAGG + Intergenic
999583831 5:153068610-153068632 GGGAAGATGAGAACAGAAGAAGG + Intergenic
999908462 5:156169616-156169638 GAGAAAAATAGAGCAGATGCTGG + Intronic
1001385426 5:171334676-171334698 TGGAAGAATGGATGAGAAGCTGG + Intergenic
1002585614 5:180245079-180245101 GGGAGGAAGAGACCAGGACCCGG - Intronic
1003488561 6:6600682-6600704 TTGGAGAAAAGACCAGAAGCAGG - Intronic
1003768565 6:9269919-9269941 GGCAAGAAAATACCTGAAGCTGG - Intergenic
1004585775 6:16998582-16998604 GTGGAAAATAGACCAGAAACTGG - Intergenic
1004816758 6:19319402-19319424 TGGGAGAATAGACTAGAAGCAGG - Intergenic
1005966749 6:30731887-30731909 TGGAAGGATACACAAGAAGCTGG - Intronic
1006626912 6:35404122-35404144 GGTAAGACTGGACCAGGAGCTGG - Intronic
1006885229 6:37376125-37376147 GGCATGAATAGTCCAGAGGCAGG - Intronic
1007064812 6:38979168-38979190 GGGAAGAATAAAACTGAAGCTGG - Intronic
1007363013 6:41372077-41372099 GCGTAGAATAGGCGAGAAGCGGG - Intergenic
1007656101 6:43451892-43451914 TGGAAGGTTAGACCAGAACCTGG - Intronic
1009559197 6:65217748-65217770 TGTAAAAATAAACCAGAAGCTGG + Intronic
1011475078 6:87743732-87743754 GGGAAGAAATGAGCAGAACCTGG + Intergenic
1013182567 6:107730742-107730764 GGGAACCATAGTCCACAAGCAGG - Intronic
1013298816 6:108783692-108783714 GGAAAGAATCCAACAGAAGCAGG + Intergenic
1013349615 6:109293479-109293501 AGGAAAAGAAGACCAGAAGCTGG + Intergenic
1015198581 6:130552489-130552511 AGGGAGAAGAGAACAGAAGCAGG - Intergenic
1015255116 6:131170337-131170359 GGAATGAATAGAGCAGAATCTGG + Intronic
1015704885 6:136076979-136077001 GGTAAGAATACACCATATGCGGG + Intronic
1015805017 6:137100122-137100144 GGACAGAATTGACCAGATGCTGG + Intergenic
1016890837 6:149005348-149005370 GGAAAGAAGACTCCAGAAGCTGG + Intronic
1019058553 6:169239975-169239997 GGGAAGAAAAGACGGGCAGCAGG + Intronic
1019164702 6:170090300-170090322 GGGAAGAATGGACGATGAGCAGG - Intergenic
1019645561 7:2127036-2127058 GGGAAGAACAGAGCAGACGCGGG + Intronic
1019668285 7:2263682-2263704 GGGAAGAACAGACCATGGGCTGG - Intronic
1019886812 7:3912637-3912659 GGGCAGGAGAGCCCAGAAGCGGG - Intronic
1020949734 7:14660412-14660434 AGGAAGAATAGACCAATAACAGG - Intronic
1021642707 7:22755536-22755558 GTGACTAATAGACCACAAGCAGG - Intergenic
1022701878 7:32769122-32769144 GGCAAGAAGAGAACAGAAGATGG - Intergenic
1022884521 7:34628888-34628910 GGGAAGAAGCTACCAGAAGAAGG + Intergenic
1022906114 7:34859281-34859303 GGCAAGAAGAGAACAGAAGATGG - Intronic
1023575517 7:41622267-41622289 GGGAAGAAAGGACAAGAAGGAGG + Intergenic
1023880814 7:44320316-44320338 GGTCAGAGTAGACCACAAGCTGG + Intronic
1025940510 7:66073454-66073476 GAGAAGAAGAGACCAGTGGCTGG - Intergenic
1026405490 7:70061342-70061364 GGAAAGAAAACACCAGAATCAGG - Intronic
1026966572 7:74443925-74443947 GGGAATACTTGGCCAGAAGCAGG - Intergenic
1028042584 7:86073532-86073554 GGGAAGAAGAGAGAAGAAGAGGG - Intergenic
1028855801 7:95591663-95591685 GGGATAAAGAGACCAGAAGTAGG - Intronic
1029345024 7:99972085-99972107 GGGAAGAAAAGGCCAGTGGCAGG - Intronic
1030104446 7:105975136-105975158 GGGAAGATTAAACCAGATGGAGG - Intronic
1030202262 7:106917626-106917648 GGGAAGAGTATCCCAGAGGCAGG + Intergenic
1030237908 7:107286996-107287018 GGGAATAACATACGAGAAGCAGG + Intronic
1030286879 7:107836197-107836219 GGGGAAAATAGACAAGAAGAAGG - Intergenic
1031550542 7:123106592-123106614 GAAAAGAATGGACCAGAAGAAGG + Intergenic
1032300619 7:130682736-130682758 AGGAAGAAAAGGCCAGAAGTTGG + Intronic
1033704873 7:143876698-143876720 GGGAAGAATAGCCCAGCTACTGG - Intronic
1036377457 8:8213263-8213285 GGGAACAAAAGACCTGAGGCTGG - Intergenic
1037157939 8:15728597-15728619 GGGGAGAATGGGACAGAAGCAGG + Intronic
1037409777 8:18584080-18584102 GGGAACAATAGACCTGAAAAAGG + Intronic
1037789816 8:21927848-21927870 GGGAGGAATAGATAAGAAGTTGG - Intronic
1038145326 8:24889466-24889488 GGGAAGAATTGAGGAGAAGCAGG + Intergenic
1039533728 8:38288443-38288465 GGGTGGAAGAGACCAGAACCTGG - Intronic
1041352424 8:56961184-56961206 GTGAAGAAAAGACCAGGAGCTGG + Exonic
1041462923 8:58131532-58131554 GGGAAGAATAAAACAGGAGACGG - Intronic
1042119546 8:65470723-65470745 TGGATGAATAGACAGGAAGCTGG - Intergenic
1044371662 8:91419359-91419381 AGGAAGATTAGACAAGAACCAGG + Intergenic
1044838284 8:96316215-96316237 GAGAAGACAAGAGCAGAAGCAGG - Intronic
1046784131 8:118247917-118247939 GGGAAAAAAATACTAGAAGCAGG + Intronic
1048514579 8:135094318-135094340 GGTAGGAATACACCAAAAGCAGG + Intergenic
1049928091 9:429254-429276 GGGAAAAATAGGCCAGGAACGGG - Intronic
1051145656 9:14024732-14024754 AGGAAGAATAGAAAAGAAGAAGG + Intergenic
1051782166 9:20701256-20701278 AGGAAGAAATGTCCAGAAGCAGG - Intronic
1056281730 9:85048104-85048126 GGGAAGAGCATACCAGAACCAGG - Intergenic
1057966826 9:99512384-99512406 AGGAAGAATAGACAATCAGCTGG - Intergenic
1058413669 9:104763322-104763344 GGGAGGACTAGACCAGAGGTCGG + Intergenic
1058727870 9:107820607-107820629 GGGAAGAAAGGAAAAGAAGCAGG + Intergenic
1059318677 9:113449275-113449297 AGGAAGAATGAACCAGAACCCGG + Intronic
1059652751 9:116331102-116331124 GGGATGAAAAGACCAGAATCTGG - Intronic
1059775078 9:117466106-117466128 GGGAAGAATAGAGAGGAAGAAGG + Intergenic
1060498827 9:124137503-124137525 GGGAAGGAAGGACTAGAAGCTGG - Intergenic
1061054560 9:128215526-128215548 GGGAAGCAGAGACTAGAGGCAGG - Intronic
1061075882 9:128341033-128341055 GGCAAGAAGAGGCCAGAAGAGGG - Intronic
1061354791 9:130096368-130096390 GGGAACAATAGAGCAGGAGAGGG - Intronic
1062514703 9:136926808-136926830 GGGAAGAACATTCCAGAAGAGGG - Intronic
1062536779 9:137024513-137024535 GGTCAGAGTAGACCACAAGCTGG - Intronic
1185711599 X:2308195-2308217 GGCAAGAACAGAAAAGAAGCAGG + Intronic
1187084089 X:16023634-16023656 TGGAAGATGAGACCTGAAGCAGG + Intergenic
1187768977 X:22674274-22674296 GGAAAGAACAGTCAAGAAGCAGG - Intergenic
1187892871 X:23953538-23953560 GGAAAGAATGAACCAGAAACAGG - Intergenic
1188450093 X:30300283-30300305 GGGAAGAAGAGACCATAAAGTGG + Intergenic
1189739296 X:44101910-44101932 GGGAACACTAGAAAAGAAGCAGG + Intergenic
1190449819 X:50567637-50567659 GGGAAGAACAGACAAGAAGTGGG - Intergenic
1190930826 X:54948572-54948594 GGAAAGAATAGCACAGAGGCTGG - Intronic
1192560197 X:72123324-72123346 GGGAAGAAAATGCCAAAAGCAGG + Intergenic
1194039585 X:88923205-88923227 GTCAAGAATAGACTTGAAGCAGG - Intergenic
1197634784 X:128902744-128902766 GGGAAGAAAAGGCAGGAAGCGGG + Intergenic
1197679894 X:129371212-129371234 TGGAAGAATACTCAAGAAGCTGG + Intergenic
1198145854 X:133857181-133857203 AGGAAGAATAGGTCAGAAGAAGG - Intronic
1199530891 X:148846575-148846597 GAGGAGAAAAGACCAGAAGTTGG + Intronic
1201767395 Y:17584770-17584792 TGGTAGAATAGACCAGAATAGGG + Intergenic
1201834158 Y:18321215-18321237 TGGTAGAATAGACCAGAATAGGG - Intergenic