ID: 1122539536

View in Genome Browser
Species Human (GRCh38)
Location 14:102490189-102490211
Sequence GATCCTGTGCTGCTTCCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 169}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122539530_1122539536 19 Left 1122539530 14:102490147-102490169 CCTTGGTCACTGTGAGCAAACAG 0: 1
1: 0
2: 4
3: 13
4: 175
Right 1122539536 14:102490189-102490211 GATCCTGTGCTGCTTCCCACTGG 0: 1
1: 0
2: 1
3: 19
4: 169
1122539529_1122539536 23 Left 1122539529 14:102490143-102490165 CCTTCCTTGGTCACTGTGAGCAA 0: 1
1: 0
2: 0
3: 23
4: 207
Right 1122539536 14:102490189-102490211 GATCCTGTGCTGCTTCCCACTGG 0: 1
1: 0
2: 1
3: 19
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122539536 Original CRISPR GATCCTGTGCTGCTTCCCAC TGG Intronic
900354478 1:2253698-2253720 GAGCTGGTGCTGCTGCCCACAGG + Intronic
900375468 1:2352524-2352546 GACCCTGTGCTGCGTGGCACAGG - Intronic
900472313 1:2860995-2861017 GCCTCTGTGCTGCTTCCCTCTGG + Intergenic
900969809 1:5985337-5985359 GCTTCTGTGCTGCTGCCCACGGG - Intronic
900984639 1:6066246-6066268 CATCCTTTGCTGCTTCACGCTGG - Intronic
901200325 1:7463230-7463252 AATCCTCTGCGGCTTCCCCCAGG + Intronic
901710701 1:11112664-11112686 GAGCCTCTGCAGCCTCCCACGGG + Intronic
901965077 1:12859765-12859787 GGCCCTGTCCTGCTTCCCAGAGG + Exonic
902005009 1:13225339-13225361 GCTCCTGTCCTGCTCCCCAGAGG - Intergenic
902744697 1:18465840-18465862 CATCCTCTGCAGCTTCCCACTGG + Intergenic
902974524 1:20079432-20079454 GAGCCTGTGATGTTACCCACTGG + Intronic
903226360 1:21896110-21896132 GAGACTGTGCTTCTTCCCACTGG - Intronic
903682143 1:25104229-25104251 CATCCTTTGCTGATTCCCAGAGG + Intergenic
904458907 1:30663861-30663883 GAGGCCCTGCTGCTTCCCACTGG - Intergenic
905309000 1:37036755-37036777 CAGCCTGTGCTGCTTCCCTGGGG - Intergenic
907996378 1:59636967-59636989 GCATCTGTGCTACTTCCCACTGG - Intronic
908340319 1:63171597-63171619 TTTCCTGTGCAGCTTCCCAAGGG - Intergenic
908689744 1:66765179-66765201 AATCATGTGCTGCCTCCCAGTGG - Intronic
910244386 1:85123012-85123034 GAACCTGTAAGGCTTCCCACTGG + Intronic
912798929 1:112709113-112709135 GATGCTTAACTGCTTCCCACAGG + Intronic
914386107 1:147172040-147172062 GATCTTGTGCTCCTTCCCCGGGG + Exonic
919866407 1:201786407-201786429 GTTCTTCTGCTGCTTCCTACAGG + Exonic
920777022 1:208948821-208948843 CATCCTGTTCTGCTTTCCAGAGG - Intergenic
1067272306 10:44803069-44803091 CACCCTGTGCTTCTGCCCACTGG + Intergenic
1067697444 10:48546153-48546175 GCTTCTGCGCTGCCTCCCACAGG + Intronic
1067934960 10:50602307-50602329 GAGAATGTTCTGCTTCCCACAGG + Intronic
1070140614 10:73734704-73734726 GAGCAGGTGCTGCTTCGCACAGG + Intergenic
1070411949 10:76149993-76150015 GGCCATTTGCTGCTTCCCACAGG + Intronic
1070448578 10:76534046-76534068 GATCCTGTGCTTTGCCCCACAGG + Intronic
1071482805 10:86077959-86077981 GATCCTGTGAGGCTGCCCAAGGG + Intronic
1073149383 10:101301613-101301635 GGTCCTCTGCTGCCTCCCTCTGG - Intergenic
1076202904 10:128572655-128572677 GCGTCTGTGCTGCTTCCCTCTGG + Intergenic
1076720456 10:132390086-132390108 GGTCCTGTGCTGCTCCCTCCAGG - Intergenic
1076839004 10:133036164-133036186 GATCCTGAGCGGCCTCCCCCAGG + Intergenic
1077186301 11:1236854-1236876 GGCTCTGTGCTGCCTCCCACGGG + Intronic
1077917913 11:6622984-6623006 GCTCCCGTGGTGCTTCCCGCCGG + Exonic
1077999284 11:7480426-7480448 GATCCTGTGTTGTTTACAACAGG - Intergenic
1078006315 11:7535089-7535111 GATACTGAGCTGTTTCCCAGGGG + Intronic
1081522222 11:43893386-43893408 GATCCTGTGTTTATTCCCACTGG - Intronic
1084802312 11:71553073-71553095 GATTCTCTTCTGCTGCCCACAGG + Intronic
1085058691 11:73424797-73424819 GATCCTTTGCTGCTGCCCTAGGG + Intronic
1088017088 11:105074057-105074079 AATCTTGTGCTCCTTGCCACTGG + Intronic
1088898512 11:114095796-114095818 GAGCCTGGTCTGCTTCCCATGGG - Intronic
1091054808 11:132407933-132407955 GACCCTGTCCACCTTCCCACTGG - Intergenic
1091457300 12:617583-617605 GCTGCTGTGCTTCTTCTCACAGG + Intronic
1091851905 12:3706270-3706292 GATGCTGAGCTGCGTCTCACAGG + Intronic
1092114227 12:5987250-5987272 CATGCTCTGCTGCCTCCCACAGG + Intronic
1092344534 12:7704604-7704626 GCTCCTGTGCTCCTACCAACAGG + Intergenic
1094027659 12:25975911-25975933 GACACTGTGCTGCTTCCCAAAGG - Intronic
1095174548 12:39076229-39076251 GCTCCCGTGCTATTTCCCACTGG + Intergenic
1095641276 12:44487980-44488002 GATACTATGCTGTTTTCCACTGG - Intergenic
1095728341 12:45476574-45476596 GATCCTGTAGTGTTTGCCACAGG - Intergenic
1097103325 12:56604715-56604737 GATCCTGCGCTGCTTCCTTATGG - Exonic
1098394834 12:70006377-70006399 TATCCTGCCCTGCCTCCCACAGG + Intergenic
1102548438 12:113673640-113673662 AACCCAGTGCTGCTCCCCACTGG - Intergenic
1104569082 12:129909383-129909405 GCCCCTGTTCTGCTTCCCACTGG + Intergenic
1104676820 12:130716789-130716811 GATCCTGTGCTGTTTTCCCAGGG - Intergenic
1109676200 13:65677762-65677784 GGTTCTGAGCTGATTCCCACTGG + Intergenic
1114185868 14:20401754-20401776 CATCCTGTGCTGCTTACCATGGG - Intronic
1114865462 14:26588479-26588501 GATTCTTTGCTGCTTCCTGCAGG - Intronic
1115507232 14:34104145-34104167 GCTCATGTGCTGCTTCCCAGGGG + Intronic
1116394310 14:44429828-44429850 GGTCCTTTGCTGATTCCAACTGG + Intergenic
1119228145 14:72959866-72959888 GTTCTACTGCTGCTTCCCACTGG - Intergenic
1119659550 14:76440483-76440505 GCTCCTGTCCTGATTCCAACAGG - Intronic
1121224277 14:92309780-92309802 GACTCTGTGCAGCTGCCCACAGG + Intergenic
1121548543 14:94780791-94780813 GAGCCTGTGCTGTTTCCCTGTGG + Intergenic
1122416054 14:101550002-101550024 CATCCTGTGCTGCTGGCCACAGG + Intergenic
1122539536 14:102490189-102490211 GATCCTGTGCTGCTTCCCACTGG + Intronic
1123932957 15:25180707-25180729 GAACCTGGGCTGCCTCCCAGAGG - Intergenic
1124442373 15:29696517-29696539 GATCCAGTGCTGCTGCCCCTGGG - Intergenic
1130082867 15:80749801-80749823 GACCCTGTGCTGGGTGCCACAGG + Intronic
1131070332 15:89461784-89461806 TATCCTGAGCTGCTGCCCAGTGG - Intergenic
1131151045 15:90047398-90047420 CATCCTCTGCTACTTCCCAATGG - Intronic
1132359402 15:101200369-101200391 GAGCCTGGCCTGCTTCTCACAGG + Intronic
1133811762 16:9166249-9166271 GAGCCCGTGCTGCTCCGCACTGG + Intergenic
1135510032 16:23074623-23074645 TATCCTGCCCTGCTTCCCTCAGG + Intronic
1139235098 16:65329506-65329528 GACCCTGTCCTGCATCCCTCAGG - Intergenic
1139701671 16:68711576-68711598 GCCTCTGTTCTGCTTCCCACTGG + Intronic
1142517728 17:443608-443630 GACCCTATGCTGCTTCTCACTGG - Intronic
1143687002 17:8525313-8525335 GTTTCTGTGCTTCTTCTCACTGG + Intronic
1144906715 17:18643118-18643140 GATGCTCTGATGCTTGCCACAGG - Intronic
1148219719 17:45852869-45852891 GCTCCTGTGCTGCCACCTACTGG + Intergenic
1152444029 17:80330241-80330263 CATCATGTGCTGCTTCCTCCAGG + Intronic
1153372315 18:4333319-4333341 TAGCCTGTGCTTCTTCCCATGGG + Intronic
1158541015 18:58354717-58354739 TATCCCCTGCTACTTCCCACTGG - Intronic
1158564123 18:58539817-58539839 GCTGTTGTCCTGCTTCCCACGGG - Intronic
1160394737 18:78563446-78563468 CAGCCCGTGCTGCTTCCCCCGGG + Intergenic
1161458629 19:4382726-4382748 GGTGCTGTCCTGCTTGCCACAGG + Intronic
1162117482 19:8439766-8439788 GAGCCTTTGCTTCTTCCCATGGG - Intronic
1162243856 19:9382466-9382488 AATCCTGTGCTGCTTATCTCTGG + Exonic
1163041562 19:14606845-14606867 GATCCTGTTCTGCATACCATGGG + Intronic
1163893876 19:20040455-20040477 GATCCAGTGCTTCTTACCCCTGG + Intergenic
1164505566 19:28858290-28858312 GATCCTGTGTTGCCACCGACTGG + Intergenic
1167529050 19:50003433-50003455 GACCCTGAGCTGCTGCTCACGGG + Intronic
1168411652 19:56143950-56143972 GCACCTGTGCTGCCTCCCGCTGG - Intronic
925316905 2:2933599-2933621 GATGCTGAGCTGCTCCCCTCAGG + Intergenic
927156015 2:20222244-20222266 GTTTCTGACCTGCTTCCCACTGG + Intronic
927577218 2:24209668-24209690 CTTCCTTTGCTGCTTCCCACGGG - Intronic
927589057 2:24336970-24336992 GAGCCTGTTCTGCTTCCTGCTGG - Intronic
927667725 2:25043651-25043673 GAGGCTGTGCTGCTGACCACTGG + Intronic
928177789 2:29046775-29046797 TGTGCTGTGCTGCTTCCCCCTGG + Intronic
937081893 2:119146230-119146252 GCTCCTGTGCTCCTTCCCAGTGG - Intergenic
938384345 2:130853704-130853726 GGTGCTGTGCTGACTCCCACTGG - Intronic
938760812 2:134424254-134424276 TATCCTGTTCTGTTTCCCAGAGG - Intronic
941516425 2:166485972-166485994 TAGCCTGTGCTGCTTCTCAGCGG + Intronic
943583440 2:189711322-189711344 GATCCTGTGCAGCTTCCATGTGG - Intronic
944412835 2:199459244-199459266 GCTCCTGTGCGGCCTCCCCCCGG - Intronic
944619951 2:201504250-201504272 GCTCCTGTGCTGCTGCCTTCAGG + Intronic
945648450 2:212531070-212531092 GATCCTGTGTTACTTCTCATGGG + Intronic
947371327 2:229449598-229449620 GAACCTGCACTGCTCCCCACTGG - Intronic
947926931 2:233929568-233929590 AATCCAGTGCCACTTCCCACAGG - Intronic
1169160386 20:3372662-3372684 GAGCCTGTGCTCCTAACCACTGG - Intronic
1174067469 20:47875626-47875648 CAGCCTGGGCTGCTTCCCACTGG - Intergenic
1175391926 20:58632888-58632910 GTTGCTGTGCGGCTTTCCACAGG + Intergenic
1176056635 20:63152381-63152403 GATGCTGTGCTGCCTCCGCCTGG - Intergenic
1176085176 20:63292641-63292663 GACCCTGGGCTGCTCCCAACTGG - Intergenic
1177779404 21:25607126-25607148 GAACGTGCGCTGCTTCCCAGAGG + Intronic
1178105810 21:29317990-29318012 AATCCTGTGGTGTTTGCCACTGG + Intronic
1178384271 21:32136815-32136837 AACCCAGTGATGCTTCCCACCGG - Intergenic
1179546075 21:42113074-42113096 GAGCCTGTGCTGCTTAGCAGAGG - Intronic
1179642038 21:42754094-42754116 GATCCTGAGCTGCCTCCCCCTGG - Intronic
1180729145 22:17968378-17968400 GCTCCTGTGCTGCTCCCCCGTGG - Intronic
1182401166 22:30079228-30079250 TATCCTGTGGTGCTTTCCAAAGG - Intergenic
1182840345 22:33384302-33384324 TATCCTGTGCTGTTGCCCAGGGG - Exonic
1183526425 22:38325909-38325931 GACCCTGAGAAGCTTCCCACCGG - Intronic
1183573427 22:38671398-38671420 GATCCTGTGCAGACTCCAACTGG - Intronic
1184825644 22:46949002-46949024 GCTCCACTCCTGCTTCCCACAGG - Intronic
1185359940 22:50400093-50400115 GACCCACTGCTGCTTCCCACTGG - Intronic
1185402697 22:50627019-50627041 GAACCTGACCTGCTTCCCGCCGG - Exonic
950392687 3:12709032-12709054 CACCCAGTGCTGCTTCCCACAGG - Intergenic
950658901 3:14454315-14454337 GAGCCTGTGCAGCTTCCTCCTGG + Intronic
952132707 3:30383823-30383845 GACCCAGTGCTGGTTTCCACAGG - Intergenic
953212953 3:40892575-40892597 CATCCTGTGCACCTTCCCCCAGG + Intergenic
953339762 3:42123483-42123505 GATCCTGGGGTGCTCCACACGGG - Intronic
954560220 3:51550175-51550197 GCTCCTGTGCTGCCTCCTAAGGG + Intronic
961162984 3:124745279-124745301 GATCCTGTGCCACTTCCTGCAGG - Intergenic
961556773 3:127701501-127701523 AACCCTGTGGTGCTTCCCATGGG + Intronic
964763295 3:160154598-160154620 GATAGTTTGCTGGTTCCCACAGG - Intergenic
967346399 3:188461161-188461183 GATGGTGAGCTCCTTCCCACTGG + Intronic
969621049 4:8279049-8279071 CACCCTGTGCTGGTTACCACTGG + Intronic
970704235 4:18781527-18781549 GATCCTGTACATCTCCCCACAGG - Intergenic
974420251 4:61663424-61663446 GCACCTGTGCTGCTGCCCAAAGG + Intronic
983904712 4:173170118-173170140 GACCCTGACCTGCTTCCCCCCGG + Intronic
987114554 5:14715605-14715627 GCCCTTGTCCTGCTTCCCACAGG + Intronic
990405202 5:55483071-55483093 TATCCTGTGTTACTTCCCCCAGG + Intronic
992186736 5:74251543-74251565 GATACTGTGCTGATTCCAATAGG - Intergenic
992533579 5:77674922-77674944 TATTTAGTGCTGCTTCCCACCGG - Intergenic
992657817 5:78928104-78928126 CATCCTGTGCTTCTTGACACTGG - Intronic
995675985 5:114663182-114663204 GATGCTGTGCTGCTTCCCTCTGG + Intergenic
996083824 5:119283726-119283748 GCTCATGAGCTGCCTCCCACAGG - Intronic
996462039 5:123756456-123756478 GATTCTGGGCTGCTTCCAAATGG + Intergenic
997525423 5:134549918-134549940 GGTCCTGTGCTGGGGCCCACAGG + Intronic
997537284 5:134632676-134632698 GATCCATAGCTGCTGCCCACCGG + Intronic
998424626 5:142015842-142015864 TCTCCCTTGCTGCTTCCCACTGG + Intergenic
998449836 5:142225750-142225772 GGTCCAGGGCTGATTCCCACAGG + Intergenic
1001658654 5:173373873-173373895 GGTTCTGTGCTTGTTCCCACTGG - Intergenic
1003515951 6:6818846-6818868 TGTCCTGTGCAGATTCCCACTGG - Intergenic
1004291033 6:14367616-14367638 GACCCTGTGCTGCTTTCAAGGGG + Intergenic
1006193083 6:32221224-32221246 GATCCAGTGCCACTGCCCACCGG - Exonic
1006798618 6:36745759-36745781 GATCCCTGGCTGCTTCCCTCAGG + Intronic
1007594012 6:43040391-43040413 GCTCTTGTGCTCCTTGCCACTGG + Exonic
1012692198 6:102328025-102328047 GATTCTGTGATGCGTCCCCCAGG - Intergenic
1015074345 6:129136907-129136929 GATCCTGGTATCCTTCCCACTGG - Intronic
1018395317 6:163373872-163373894 GTTCCTGTCCTTCTTCCCACAGG + Intergenic
1018567292 6:165168254-165168276 AAACCTGTGCTGCTTCCAAGGGG + Intergenic
1018977216 6:168574674-168574696 CATCCTGTGCTGTCACCCACCGG - Intronic
1023942184 7:44776302-44776324 GATCCTGTGCGGCTTCCATCAGG - Intergenic
1024426913 7:49236492-49236514 GGTCCTGTGCTGCTTTTCAAGGG + Intergenic
1024894842 7:54246001-54246023 TCTCCTGTCCTTCTTCCCACTGG + Intergenic
1026870278 7:73846865-73846887 GCCCCTGTGCTGCTGACCACTGG - Intergenic
1030867988 7:114722889-114722911 GATCCTTTTCTTCTGCCCACTGG + Intergenic
1031890241 7:127286086-127286108 GATCCTGCTCTGCTCCCCGCTGG + Intergenic
1032689203 7:134265828-134265850 GAACCTCTTCTCCTTCCCACTGG + Intergenic
1035281982 7:157784365-157784387 GCTCGTTTGCTGCTTCACACTGG + Intronic
1035522322 8:284714-284736 GGACCTGTGCTGTTCCCCACGGG + Intergenic
1047373899 8:124278223-124278245 AATCAGGTGCTGCTTCCCAGAGG - Intergenic
1048193427 8:132310879-132310901 GAACATCTGCTGCTTCCCAGTGG - Intronic
1049259113 8:141629388-141629410 GAGCCTGTGCTGCCTGCCGCTGG + Intergenic
1049439010 8:142600785-142600807 GAGCCTGAGCTGCTTCCTCCAGG - Intergenic
1053020909 9:34693320-34693342 GATCAGTTGCTGCTTCCCATGGG - Intergenic
1056820918 9:89841585-89841607 GAGCTTGTGCTGGTTCCCACTGG - Intergenic
1057527074 9:95812246-95812268 GACCCTGTCCTCCTTCCCTCTGG + Intergenic
1058777851 9:108302814-108302836 TTTCCTGTGCTTCTTCTCACAGG + Intergenic
1059145540 9:111896640-111896662 GATCGTGTCCTGCTGCCCGCAGG - Intergenic
1186440222 X:9579693-9579715 TAAGCAGTGCTGCTTCCCACAGG - Intronic
1186808099 X:13160467-13160489 GGGCCTGTGCTGCTTCCAGCTGG - Intergenic
1187432397 X:19237100-19237122 GAGCCTTAGCTGCTTCCCAAAGG + Intergenic
1192148808 X:68699179-68699201 GGCCCTTGGCTGCTTCCCACAGG - Intronic
1194594252 X:95837498-95837520 GGCTCTGTGCTGCTCCCCACTGG + Intergenic
1200836854 Y:7740609-7740631 GCTTCTGTACTGCCTCCCACAGG + Intergenic