ID: 1122542732

View in Genome Browser
Species Human (GRCh38)
Location 14:102507116-102507138
Sequence TGCTGGGCGACCGGCCGCGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 83}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122542732_1122542740 1 Left 1122542732 14:102507116-102507138 CCAGCGCGGCCGGTCGCCCAGCA 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1122542740 14:102507140-102507162 CTCCTGGCGGGCCGAGCCGGCGG 0: 1
1: 0
2: 2
3: 3
4: 148
1122542732_1122542745 12 Left 1122542732 14:102507116-102507138 CCAGCGCGGCCGGTCGCCCAGCA 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1122542745 14:102507151-102507173 CCGAGCCGGCGGCACCCACGGGG 0: 1
1: 0
2: 2
3: 6
4: 70
1122542732_1122542742 10 Left 1122542732 14:102507116-102507138 CCAGCGCGGCCGGTCGCCCAGCA 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1122542742 14:102507149-102507171 GGCCGAGCCGGCGGCACCCACGG 0: 1
1: 0
2: 1
3: 19
4: 165
1122542732_1122542746 13 Left 1122542732 14:102507116-102507138 CCAGCGCGGCCGGTCGCCCAGCA 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1122542746 14:102507152-102507174 CGAGCCGGCGGCACCCACGGGGG 0: 1
1: 0
2: 1
3: 38
4: 89
1122542732_1122542739 -2 Left 1122542732 14:102507116-102507138 CCAGCGCGGCCGGTCGCCCAGCA 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1122542739 14:102507137-102507159 CAGCTCCTGGCGGGCCGAGCCGG 0: 1
1: 0
2: 1
3: 27
4: 274
1122542732_1122542743 11 Left 1122542732 14:102507116-102507138 CCAGCGCGGCCGGTCGCCCAGCA 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1122542743 14:102507150-102507172 GCCGAGCCGGCGGCACCCACGGG 0: 1
1: 0
2: 1
3: 10
4: 121
1122542732_1122542751 30 Left 1122542732 14:102507116-102507138 CCAGCGCGGCCGGTCGCCCAGCA 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1122542751 14:102507169-102507191 CGGGGGTGTACAGCGCCAGGAGG 0: 1
1: 0
2: 0
3: 8
4: 71
1122542732_1122542750 27 Left 1122542732 14:102507116-102507138 CCAGCGCGGCCGGTCGCCCAGCA 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1122542750 14:102507166-102507188 CCACGGGGGTGTACAGCGCCAGG 0: 1
1: 0
2: 0
3: 4
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122542732 Original CRISPR TGCTGGGCGACCGGCCGCGC TGG (reversed) Exonic