ID: 1122543287

View in Genome Browser
Species Human (GRCh38)
Location 14:102509465-102509487
Sequence TGCGCGTGTGCCGGAGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 224}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122543275_1122543287 30 Left 1122543275 14:102509412-102509434 CCGAGCGGGGCGTCCGCGCGCAG 0: 1
1: 0
2: 0
3: 4
4: 65
Right 1122543287 14:102509465-102509487 TGCGCGTGTGCCGGAGGAGGAGG 0: 1
1: 0
2: 2
3: 29
4: 224
1122543279_1122543287 17 Left 1122543279 14:102509425-102509447 CCGCGCGCAGGTGGCCGGCGCAG 0: 1
1: 0
2: 5
3: 7
4: 115
Right 1122543287 14:102509465-102509487 TGCGCGTGTGCCGGAGGAGGAGG 0: 1
1: 0
2: 2
3: 29
4: 224
1122543282_1122543287 3 Left 1122543282 14:102509439-102509461 CCGGCGCAGCGAGGGCTGCACCT 0: 1
1: 0
2: 0
3: 5
4: 135
Right 1122543287 14:102509465-102509487 TGCGCGTGTGCCGGAGGAGGAGG 0: 1
1: 0
2: 2
3: 29
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122543287 Original CRISPR TGCGCGTGTGCCGGAGGAGG AGG Intronic