ID: 1122551456

View in Genome Browser
Species Human (GRCh38)
Location 14:102552319-102552341
Sequence GTCCCACTTGCTGTTCTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122551448_1122551456 22 Left 1122551448 14:102552274-102552296 CCAAGTCAAGCCACACCTCTCTT No data
Right 1122551456 14:102552319-102552341 GTCCCACTTGCTGTTCTGCCAGG No data
1122551453_1122551456 -1 Left 1122551453 14:102552297-102552319 CCGGCTGGAGCAGCCTGACCAAG No data
Right 1122551456 14:102552319-102552341 GTCCCACTTGCTGTTCTGCCAGG No data
1122551452_1122551456 7 Left 1122551452 14:102552289-102552311 CCTCTCTTCCGGCTGGAGCAGCC No data
Right 1122551456 14:102552319-102552341 GTCCCACTTGCTGTTCTGCCAGG No data
1122551451_1122551456 12 Left 1122551451 14:102552284-102552306 CCACACCTCTCTTCCGGCTGGAG No data
Right 1122551456 14:102552319-102552341 GTCCCACTTGCTGTTCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122551456 Original CRISPR GTCCCACTTGCTGTTCTGCC AGG Intergenic
No off target data available for this crispr