ID: 1122552266

View in Genome Browser
Species Human (GRCh38)
Location 14:102556440-102556462
Sequence GATCAGGCCCAATCCTCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122552266_1122552269 -2 Left 1122552266 14:102556440-102556462 CCCAAGGAGGATTGGGCCTGATC No data
Right 1122552269 14:102556461-102556483 TCTCTGCCCCCCAGAGCCCATGG No data
1122552266_1122552277 11 Left 1122552266 14:102556440-102556462 CCCAAGGAGGATTGGGCCTGATC No data
Right 1122552277 14:102556474-102556496 GAGCCCATGGACCCAGGACTGGG No data
1122552266_1122552280 20 Left 1122552266 14:102556440-102556462 CCCAAGGAGGATTGGGCCTGATC No data
Right 1122552280 14:102556483-102556505 GACCCAGGACTGGGCCCACCAGG No data
1122552266_1122552272 5 Left 1122552266 14:102556440-102556462 CCCAAGGAGGATTGGGCCTGATC No data
Right 1122552272 14:102556468-102556490 CCCCCAGAGCCCATGGACCCAGG No data
1122552266_1122552276 10 Left 1122552266 14:102556440-102556462 CCCAAGGAGGATTGGGCCTGATC No data
Right 1122552276 14:102556473-102556495 AGAGCCCATGGACCCAGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122552266 Original CRISPR GATCAGGCCCAATCCTCCTT GGG (reversed) Intergenic
No off target data available for this crispr