ID: 1122552267

View in Genome Browser
Species Human (GRCh38)
Location 14:102556441-102556463
Sequence AGATCAGGCCCAATCCTCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122552267_1122552272 4 Left 1122552267 14:102556441-102556463 CCAAGGAGGATTGGGCCTGATCT No data
Right 1122552272 14:102556468-102556490 CCCCCAGAGCCCATGGACCCAGG No data
1122552267_1122552283 30 Left 1122552267 14:102556441-102556463 CCAAGGAGGATTGGGCCTGATCT No data
Right 1122552283 14:102556494-102556516 GGGCCCACCAGGCGTGTCGCAGG No data
1122552267_1122552277 10 Left 1122552267 14:102556441-102556463 CCAAGGAGGATTGGGCCTGATCT No data
Right 1122552277 14:102556474-102556496 GAGCCCATGGACCCAGGACTGGG No data
1122552267_1122552276 9 Left 1122552267 14:102556441-102556463 CCAAGGAGGATTGGGCCTGATCT No data
Right 1122552276 14:102556473-102556495 AGAGCCCATGGACCCAGGACTGG No data
1122552267_1122552269 -3 Left 1122552267 14:102556441-102556463 CCAAGGAGGATTGGGCCTGATCT No data
Right 1122552269 14:102556461-102556483 TCTCTGCCCCCCAGAGCCCATGG No data
1122552267_1122552280 19 Left 1122552267 14:102556441-102556463 CCAAGGAGGATTGGGCCTGATCT No data
Right 1122552280 14:102556483-102556505 GACCCAGGACTGGGCCCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122552267 Original CRISPR AGATCAGGCCCAATCCTCCT TGG (reversed) Intergenic
No off target data available for this crispr