ID: 1122552269

View in Genome Browser
Species Human (GRCh38)
Location 14:102556461-102556483
Sequence TCTCTGCCCCCCAGAGCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122552258_1122552269 26 Left 1122552258 14:102556412-102556434 CCATCAGCTGCTCTAGGGTGCAG No data
Right 1122552269 14:102556461-102556483 TCTCTGCCCCCCAGAGCCCATGG No data
1122552267_1122552269 -3 Left 1122552267 14:102556441-102556463 CCAAGGAGGATTGGGCCTGATCT No data
Right 1122552269 14:102556461-102556483 TCTCTGCCCCCCAGAGCCCATGG No data
1122552266_1122552269 -2 Left 1122552266 14:102556440-102556462 CCCAAGGAGGATTGGGCCTGATC No data
Right 1122552269 14:102556461-102556483 TCTCTGCCCCCCAGAGCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122552269 Original CRISPR TCTCTGCCCCCCAGAGCCCA TGG Intergenic
No off target data available for this crispr