ID: 1122552270

View in Genome Browser
Species Human (GRCh38)
Location 14:102556467-102556489
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122552270_1122552283 4 Left 1122552270 14:102556467-102556489 CCCCCCAGAGCCCATGGACCCAG No data
Right 1122552283 14:102556494-102556516 GGGCCCACCAGGCGTGTCGCAGG No data
1122552270_1122552280 -7 Left 1122552270 14:102556467-102556489 CCCCCCAGAGCCCATGGACCCAG No data
Right 1122552280 14:102556483-102556505 GACCCAGGACTGGGCCCACCAGG No data
1122552270_1122552288 11 Left 1122552270 14:102556467-102556489 CCCCCCAGAGCCCATGGACCCAG No data
Right 1122552288 14:102556501-102556523 CCAGGCGTGTCGCAGGCATAGGG No data
1122552270_1122552289 18 Left 1122552270 14:102556467-102556489 CCCCCCAGAGCCCATGGACCCAG No data
Right 1122552289 14:102556508-102556530 TGTCGCAGGCATAGGGTCAGTGG No data
1122552270_1122552286 10 Left 1122552270 14:102556467-102556489 CCCCCCAGAGCCCATGGACCCAG No data
Right 1122552286 14:102556500-102556522 ACCAGGCGTGTCGCAGGCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122552270 Original CRISPR CTGGGTCCATGGGCTCTGGG GGG (reversed) Intergenic
No off target data available for this crispr