ID: 1122552277

View in Genome Browser
Species Human (GRCh38)
Location 14:102556474-102556496
Sequence GAGCCCATGGACCCAGGACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122552268_1122552277 -5 Left 1122552268 14:102556456-102556478 CCTGATCTCTGCCCCCCAGAGCC No data
Right 1122552277 14:102556474-102556496 GAGCCCATGGACCCAGGACTGGG No data
1122552266_1122552277 11 Left 1122552266 14:102556440-102556462 CCCAAGGAGGATTGGGCCTGATC No data
Right 1122552277 14:102556474-102556496 GAGCCCATGGACCCAGGACTGGG No data
1122552267_1122552277 10 Left 1122552267 14:102556441-102556463 CCAAGGAGGATTGGGCCTGATCT No data
Right 1122552277 14:102556474-102556496 GAGCCCATGGACCCAGGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122552277 Original CRISPR GAGCCCATGGACCCAGGACT GGG Intergenic
No off target data available for this crispr