ID: 1122552280

View in Genome Browser
Species Human (GRCh38)
Location 14:102556483-102556505
Sequence GACCCAGGACTGGGCCCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122552267_1122552280 19 Left 1122552267 14:102556441-102556463 CCAAGGAGGATTGGGCCTGATCT No data
Right 1122552280 14:102556483-102556505 GACCCAGGACTGGGCCCACCAGG No data
1122552268_1122552280 4 Left 1122552268 14:102556456-102556478 CCTGATCTCTGCCCCCCAGAGCC No data
Right 1122552280 14:102556483-102556505 GACCCAGGACTGGGCCCACCAGG No data
1122552273_1122552280 -9 Left 1122552273 14:102556469-102556491 CCCCAGAGCCCATGGACCCAGGA No data
Right 1122552280 14:102556483-102556505 GACCCAGGACTGGGCCCACCAGG No data
1122552271_1122552280 -8 Left 1122552271 14:102556468-102556490 CCCCCAGAGCCCATGGACCCAGG No data
Right 1122552280 14:102556483-102556505 GACCCAGGACTGGGCCCACCAGG No data
1122552270_1122552280 -7 Left 1122552270 14:102556467-102556489 CCCCCCAGAGCCCATGGACCCAG No data
Right 1122552280 14:102556483-102556505 GACCCAGGACTGGGCCCACCAGG No data
1122552274_1122552280 -10 Left 1122552274 14:102556470-102556492 CCCAGAGCCCATGGACCCAGGAC No data
Right 1122552280 14:102556483-102556505 GACCCAGGACTGGGCCCACCAGG No data
1122552266_1122552280 20 Left 1122552266 14:102556440-102556462 CCCAAGGAGGATTGGGCCTGATC No data
Right 1122552280 14:102556483-102556505 GACCCAGGACTGGGCCCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122552280 Original CRISPR GACCCAGGACTGGGCCCACC AGG Intergenic
No off target data available for this crispr