ID: 1122552283

View in Genome Browser
Species Human (GRCh38)
Location 14:102556494-102556516
Sequence GGGCCCACCAGGCGTGTCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122552268_1122552283 15 Left 1122552268 14:102556456-102556478 CCTGATCTCTGCCCCCCAGAGCC No data
Right 1122552283 14:102556494-102556516 GGGCCCACCAGGCGTGTCGCAGG No data
1122552278_1122552283 -6 Left 1122552278 14:102556477-102556499 CCCATGGACCCAGGACTGGGCCC No data
Right 1122552283 14:102556494-102556516 GGGCCCACCAGGCGTGTCGCAGG No data
1122552270_1122552283 4 Left 1122552270 14:102556467-102556489 CCCCCCAGAGCCCATGGACCCAG No data
Right 1122552283 14:102556494-102556516 GGGCCCACCAGGCGTGTCGCAGG No data
1122552274_1122552283 1 Left 1122552274 14:102556470-102556492 CCCAGAGCCCATGGACCCAGGAC No data
Right 1122552283 14:102556494-102556516 GGGCCCACCAGGCGTGTCGCAGG No data
1122552267_1122552283 30 Left 1122552267 14:102556441-102556463 CCAAGGAGGATTGGGCCTGATCT No data
Right 1122552283 14:102556494-102556516 GGGCCCACCAGGCGTGTCGCAGG No data
1122552273_1122552283 2 Left 1122552273 14:102556469-102556491 CCCCAGAGCCCATGGACCCAGGA No data
Right 1122552283 14:102556494-102556516 GGGCCCACCAGGCGTGTCGCAGG No data
1122552271_1122552283 3 Left 1122552271 14:102556468-102556490 CCCCCAGAGCCCATGGACCCAGG No data
Right 1122552283 14:102556494-102556516 GGGCCCACCAGGCGTGTCGCAGG No data
1122552279_1122552283 -7 Left 1122552279 14:102556478-102556500 CCATGGACCCAGGACTGGGCCCA No data
Right 1122552283 14:102556494-102556516 GGGCCCACCAGGCGTGTCGCAGG No data
1122552275_1122552283 0 Left 1122552275 14:102556471-102556493 CCAGAGCCCATGGACCCAGGACT No data
Right 1122552283 14:102556494-102556516 GGGCCCACCAGGCGTGTCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122552283 Original CRISPR GGGCCCACCAGGCGTGTCGC AGG Intergenic
No off target data available for this crispr