ID: 1122552462

View in Genome Browser
Species Human (GRCh38)
Location 14:102557361-102557383
Sequence CAGCATCCCCTGCCCAGCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122552456_1122552462 8 Left 1122552456 14:102557330-102557352 CCTGTGACACCATGGGGACCTCT No data
Right 1122552462 14:102557361-102557383 CAGCATCCCCTGCCCAGCCGTGG No data
1122552458_1122552462 -1 Left 1122552458 14:102557339-102557361 CCATGGGGACCTCTATTGGTCCC No data
Right 1122552462 14:102557361-102557383 CAGCATCCCCTGCCCAGCCGTGG No data
1122552459_1122552462 -10 Left 1122552459 14:102557348-102557370 CCTCTATTGGTCCCAGCATCCCC No data
Right 1122552462 14:102557361-102557383 CAGCATCCCCTGCCCAGCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122552462 Original CRISPR CAGCATCCCCTGCCCAGCCG TGG Intergenic