ID: 1122554107

View in Genome Browser
Species Human (GRCh38)
Location 14:102567604-102567626
Sequence CTCAGCACTGTGGGAGGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122554107_1122554112 2 Left 1122554107 14:102567604-102567626 CCTCAGCCTCCCACAGTGCTGAG No data
Right 1122554112 14:102567629-102567651 TACAGGCGTGAGCCACCCGACGG No data
1122554107_1122554114 11 Left 1122554107 14:102567604-102567626 CCTCAGCCTCCCACAGTGCTGAG No data
Right 1122554114 14:102567638-102567660 GAGCCACCCGACGGGCTCCATGG No data
1122554107_1122554113 3 Left 1122554107 14:102567604-102567626 CCTCAGCCTCCCACAGTGCTGAG No data
Right 1122554113 14:102567630-102567652 ACAGGCGTGAGCCACCCGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122554107 Original CRISPR CTCAGCACTGTGGGAGGCTG AGG (reversed) Intergenic