ID: 1122554109

View in Genome Browser
Species Human (GRCh38)
Location 14:102567612-102567634
Sequence TCCCACAGTGCTGAGATTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122554102_1122554109 12 Left 1122554102 14:102567577-102567599 CCTCAGGTGATCCTGCAGATCCG No data
Right 1122554109 14:102567612-102567634 TCCCACAGTGCTGAGATTACAGG No data
1122554103_1122554109 1 Left 1122554103 14:102567588-102567610 CCTGCAGATCCGCCCACCTCAGC No data
Right 1122554109 14:102567612-102567634 TCCCACAGTGCTGAGATTACAGG No data
1122554104_1122554109 -8 Left 1122554104 14:102567597-102567619 CCGCCCACCTCAGCCTCCCACAG No data
Right 1122554109 14:102567612-102567634 TCCCACAGTGCTGAGATTACAGG No data
1122554101_1122554109 16 Left 1122554101 14:102567573-102567595 CCGACCTCAGGTGATCCTGCAGA No data
Right 1122554109 14:102567612-102567634 TCCCACAGTGCTGAGATTACAGG No data
1122554100_1122554109 17 Left 1122554100 14:102567572-102567594 CCCGACCTCAGGTGATCCTGCAG No data
Right 1122554109 14:102567612-102567634 TCCCACAGTGCTGAGATTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122554109 Original CRISPR TCCCACAGTGCTGAGATTAC AGG Intergenic