ID: 1122554111 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 14:102567614-102567636 |
Sequence | CGCCTGTAATCTCAGCACTG TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1122554111_1122554114 | 1 | Left | 1122554111 | 14:102567614-102567636 | CCACAGTGCTGAGATTACAGGCG | No data | ||
Right | 1122554114 | 14:102567638-102567660 | GAGCCACCCGACGGGCTCCATGG | No data | ||||
1122554111_1122554112 | -8 | Left | 1122554111 | 14:102567614-102567636 | CCACAGTGCTGAGATTACAGGCG | No data | ||
Right | 1122554112 | 14:102567629-102567651 | TACAGGCGTGAGCCACCCGACGG | No data | ||||
1122554111_1122554113 | -7 | Left | 1122554111 | 14:102567614-102567636 | CCACAGTGCTGAGATTACAGGCG | No data | ||
Right | 1122554113 | 14:102567630-102567652 | ACAGGCGTGAGCCACCCGACGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1122554111 | Original CRISPR | CGCCTGTAATCTCAGCACTG TGG (reversed) | Intergenic | ||