ID: 1122554111

View in Genome Browser
Species Human (GRCh38)
Location 14:102567614-102567636
Sequence CGCCTGTAATCTCAGCACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122554111_1122554114 1 Left 1122554111 14:102567614-102567636 CCACAGTGCTGAGATTACAGGCG No data
Right 1122554114 14:102567638-102567660 GAGCCACCCGACGGGCTCCATGG No data
1122554111_1122554112 -8 Left 1122554111 14:102567614-102567636 CCACAGTGCTGAGATTACAGGCG No data
Right 1122554112 14:102567629-102567651 TACAGGCGTGAGCCACCCGACGG No data
1122554111_1122554113 -7 Left 1122554111 14:102567614-102567636 CCACAGTGCTGAGATTACAGGCG No data
Right 1122554113 14:102567630-102567652 ACAGGCGTGAGCCACCCGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122554111 Original CRISPR CGCCTGTAATCTCAGCACTG TGG (reversed) Intergenic