ID: 1122554112

View in Genome Browser
Species Human (GRCh38)
Location 14:102567629-102567651
Sequence TACAGGCGTGAGCCACCCGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122554107_1122554112 2 Left 1122554107 14:102567604-102567626 CCTCAGCCTCCCACAGTGCTGAG No data
Right 1122554112 14:102567629-102567651 TACAGGCGTGAGCCACCCGACGG No data
1122554105_1122554112 6 Left 1122554105 14:102567600-102567622 CCCACCTCAGCCTCCCACAGTGC No data
Right 1122554112 14:102567629-102567651 TACAGGCGTGAGCCACCCGACGG No data
1122554103_1122554112 18 Left 1122554103 14:102567588-102567610 CCTGCAGATCCGCCCACCTCAGC No data
Right 1122554112 14:102567629-102567651 TACAGGCGTGAGCCACCCGACGG No data
1122554110_1122554112 -7 Left 1122554110 14:102567613-102567635 CCCACAGTGCTGAGATTACAGGC No data
Right 1122554112 14:102567629-102567651 TACAGGCGTGAGCCACCCGACGG No data
1122554102_1122554112 29 Left 1122554102 14:102567577-102567599 CCTCAGGTGATCCTGCAGATCCG No data
Right 1122554112 14:102567629-102567651 TACAGGCGTGAGCCACCCGACGG No data
1122554106_1122554112 5 Left 1122554106 14:102567601-102567623 CCACCTCAGCCTCCCACAGTGCT No data
Right 1122554112 14:102567629-102567651 TACAGGCGTGAGCCACCCGACGG No data
1122554111_1122554112 -8 Left 1122554111 14:102567614-102567636 CCACAGTGCTGAGATTACAGGCG No data
Right 1122554112 14:102567629-102567651 TACAGGCGTGAGCCACCCGACGG No data
1122554108_1122554112 -4 Left 1122554108 14:102567610-102567632 CCTCCCACAGTGCTGAGATTACA No data
Right 1122554112 14:102567629-102567651 TACAGGCGTGAGCCACCCGACGG No data
1122554104_1122554112 9 Left 1122554104 14:102567597-102567619 CCGCCCACCTCAGCCTCCCACAG No data
Right 1122554112 14:102567629-102567651 TACAGGCGTGAGCCACCCGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122554112 Original CRISPR TACAGGCGTGAGCCACCCGA CGG Intergenic