ID: 1122554113

View in Genome Browser
Species Human (GRCh38)
Location 14:102567630-102567652
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122554106_1122554113 6 Left 1122554106 14:102567601-102567623 CCACCTCAGCCTCCCACAGTGCT No data
Right 1122554113 14:102567630-102567652 ACAGGCGTGAGCCACCCGACGGG No data
1122554104_1122554113 10 Left 1122554104 14:102567597-102567619 CCGCCCACCTCAGCCTCCCACAG No data
Right 1122554113 14:102567630-102567652 ACAGGCGTGAGCCACCCGACGGG No data
1122554107_1122554113 3 Left 1122554107 14:102567604-102567626 CCTCAGCCTCCCACAGTGCTGAG No data
Right 1122554113 14:102567630-102567652 ACAGGCGTGAGCCACCCGACGGG No data
1122554108_1122554113 -3 Left 1122554108 14:102567610-102567632 CCTCCCACAGTGCTGAGATTACA No data
Right 1122554113 14:102567630-102567652 ACAGGCGTGAGCCACCCGACGGG No data
1122554102_1122554113 30 Left 1122554102 14:102567577-102567599 CCTCAGGTGATCCTGCAGATCCG No data
Right 1122554113 14:102567630-102567652 ACAGGCGTGAGCCACCCGACGGG No data
1122554105_1122554113 7 Left 1122554105 14:102567600-102567622 CCCACCTCAGCCTCCCACAGTGC No data
Right 1122554113 14:102567630-102567652 ACAGGCGTGAGCCACCCGACGGG No data
1122554111_1122554113 -7 Left 1122554111 14:102567614-102567636 CCACAGTGCTGAGATTACAGGCG No data
Right 1122554113 14:102567630-102567652 ACAGGCGTGAGCCACCCGACGGG No data
1122554110_1122554113 -6 Left 1122554110 14:102567613-102567635 CCCACAGTGCTGAGATTACAGGC No data
Right 1122554113 14:102567630-102567652 ACAGGCGTGAGCCACCCGACGGG No data
1122554103_1122554113 19 Left 1122554103 14:102567588-102567610 CCTGCAGATCCGCCCACCTCAGC No data
Right 1122554113 14:102567630-102567652 ACAGGCGTGAGCCACCCGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122554113 Original CRISPR ACAGGCGTGAGCCACCCGAC GGG Intergenic