ID: 1122554114

View in Genome Browser
Species Human (GRCh38)
Location 14:102567638-102567660
Sequence GAGCCACCCGACGGGCTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122554110_1122554114 2 Left 1122554110 14:102567613-102567635 CCCACAGTGCTGAGATTACAGGC No data
Right 1122554114 14:102567638-102567660 GAGCCACCCGACGGGCTCCATGG No data
1122554104_1122554114 18 Left 1122554104 14:102567597-102567619 CCGCCCACCTCAGCCTCCCACAG No data
Right 1122554114 14:102567638-102567660 GAGCCACCCGACGGGCTCCATGG No data
1122554111_1122554114 1 Left 1122554111 14:102567614-102567636 CCACAGTGCTGAGATTACAGGCG No data
Right 1122554114 14:102567638-102567660 GAGCCACCCGACGGGCTCCATGG No data
1122554108_1122554114 5 Left 1122554108 14:102567610-102567632 CCTCCCACAGTGCTGAGATTACA No data
Right 1122554114 14:102567638-102567660 GAGCCACCCGACGGGCTCCATGG No data
1122554106_1122554114 14 Left 1122554106 14:102567601-102567623 CCACCTCAGCCTCCCACAGTGCT No data
Right 1122554114 14:102567638-102567660 GAGCCACCCGACGGGCTCCATGG No data
1122554107_1122554114 11 Left 1122554107 14:102567604-102567626 CCTCAGCCTCCCACAGTGCTGAG No data
Right 1122554114 14:102567638-102567660 GAGCCACCCGACGGGCTCCATGG No data
1122554103_1122554114 27 Left 1122554103 14:102567588-102567610 CCTGCAGATCCGCCCACCTCAGC No data
Right 1122554114 14:102567638-102567660 GAGCCACCCGACGGGCTCCATGG No data
1122554105_1122554114 15 Left 1122554105 14:102567600-102567622 CCCACCTCAGCCTCCCACAGTGC No data
Right 1122554114 14:102567638-102567660 GAGCCACCCGACGGGCTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122554114 Original CRISPR GAGCCACCCGACGGGCTCCA TGG Intergenic